Incidental Mutation 'R8825:Trcg1'
ID 673394
Institutional Source Beutler Lab
Gene Symbol Trcg1
Ensembl Gene ENSMUSG00000070298
Gene Name taste receptor cell gene 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8825 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 57236556-57249864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57241471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 109 (T109A)
Ref Sequence ENSEMBL: ENSMUSP00000091357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093837]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093837
AA Change: T109A

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091357
Gene: ENSMUSG00000070298
AA Change: T109A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 302 335 N/A INTRINSIC
Blast:SEA 449 549 5e-21 BLAST
low complexity region 580 594 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T C 11: 29,823,696 E587G probably benign Het
5430403G16Rik T G 5: 109,678,880 T5P probably damaging Het
A430078G23Rik T A 8: 3,386,951 L247Q probably damaging Het
Arfgap2 T A 2: 91,273,561 L334Q probably damaging Het
Birc6 T A 17: 74,613,505 C2100S probably damaging Het
Bpi A G 2: 158,267,750 D206G probably benign Het
C6 T C 15: 4,731,688 I10T possibly damaging Het
Cactin A G 10: 81,325,658 T675A probably damaging Het
Cbwd1 A G 19: 24,949,237 V150A probably benign Het
Cd200 G A 16: 45,394,794 R165C probably benign Het
Cdkal1 C T 13: 29,354,794 V461I probably benign Het
Ces2g C T 8: 104,967,322 S430F probably benign Het
Clcn3 A T 8: 60,929,488 H382Q probably damaging Het
Crem A T 18: 3,268,061 V89E probably damaging Het
Crtc2 T A 3: 90,259,156 M146K probably benign Het
Depdc1b T G 13: 108,384,782 D374E possibly damaging Het
Dgkg T A 16: 22,562,769 H477L probably benign Het
Dnhd1 T A 7: 105,693,967 V1506D possibly damaging Het
Exosc10 G A 4: 148,568,702 probably null Het
Flnb G T 14: 7,887,566 G459C probably damaging Het
Gm4881 A G 7: 24,929,257 V60A possibly damaging Het
Golgb1 A G 16: 36,919,447 D2757G probably benign Het
Gsta4 T G 9: 78,208,839 probably benign Het
Herc2 T A 7: 56,050,878 M1K probably null Het
Hip1 C T 5: 135,422,122 V879M probably damaging Het
Htt T C 5: 34,825,960 Y968H probably benign Het
Ints11 T A 4: 155,885,130 Y154* probably null Het
Itih5 A G 2: 10,190,420 S208G probably benign Het
Lamb2 C T 9: 108,485,261 T701I probably benign Het
Lgals3 T A 14: 47,380,100 Y22* probably null Het
Macc1 T A 12: 119,445,852 D118E probably benign Het
Mad2l2 T C 4: 148,140,820 L9P probably damaging Het
Mark2 T C 19: 7,341,206 T6A probably benign Het
Mcat T C 15: 83,552,611 N143S probably benign Het
Med10 T G 13: 69,813,927 C144G unknown Het
Miga1 A T 3: 152,276,823 F539I probably damaging Het
Mon2 A T 10: 123,013,871 S1174T probably benign Het
Mycbp2 C A 14: 103,229,435 W1330C probably damaging Het
Myo5b T C 18: 74,759,098 S1612P possibly damaging Het
Nipal4 T C 11: 46,162,046 I31V probably benign Het
Obox3 A T 7: 15,627,301 V13E possibly damaging Het
Olfr703 A T 7: 106,845,429 I273F probably damaging Het
Olfr967 T C 9: 39,750,698 F104S probably damaging Het
Ppic A G 18: 53,409,150 V162A probably damaging Het
Prkg2 T C 5: 98,942,184 K699R probably benign Het
Prl2c2 T A 13: 13,005,071 L6F possibly damaging Het
Rnf148 G C 6: 23,654,379 S206C probably benign Het
Sec16a A G 2: 26,423,574 S474P Het
Sema5a T G 15: 32,689,352 H1054Q probably benign Het
Slc6a18 C A 13: 73,665,632 V521F probably null Het
Stat2 T A 10: 128,291,364 D921E possibly damaging Het
Tcf24 G T 1: 9,960,999 N42K unknown Het
Tgfb2 T A 1: 186,628,939 N372Y probably damaging Het
Tktl2 A C 8: 66,513,667 M626L possibly damaging Het
Tmem94 A G 11: 115,797,375 D1220G probably benign Het
Trim30a T A 7: 104,411,322 K416* probably null Het
Trpm5 T C 7: 143,083,016 K395E possibly damaging Het
Ufm1 T A 3: 53,863,672 probably null Het
Unc13b T A 4: 43,237,683 probably benign Het
Vmn2r16 T C 5: 109,339,153 V80A probably benign Het
Vmn2r77 A T 7: 86,803,647 Y524F probably benign Het
Zfp64 T C 2: 168,951,632 S65G probably benign Het
Other mutations in Trcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Trcg1 APN 9 57242273 missense probably benign
IGL01727:Trcg1 APN 9 57242594 missense probably damaging 0.97
IGL02147:Trcg1 APN 9 57245849 missense probably benign 0.20
IGL02329:Trcg1 APN 9 57240393 missense possibly damaging 0.92
IGL02658:Trcg1 APN 9 57242228 nonsense probably null
IGL02852:Trcg1 APN 9 57241312 missense possibly damaging 0.94
IGL03163:Trcg1 APN 9 57248347 missense possibly damaging 0.92
FR4589:Trcg1 UTSW 9 57242202 frame shift probably null
R0555:Trcg1 UTSW 9 57242333 missense probably damaging 1.00
R0747:Trcg1 UTSW 9 57241921 missense probably benign 0.00
R1061:Trcg1 UTSW 9 57245873 missense possibly damaging 0.66
R1521:Trcg1 UTSW 9 57242465 missense probably benign 0.36
R1622:Trcg1 UTSW 9 57248672 missense possibly damaging 0.94
R1652:Trcg1 UTSW 9 57245573 missense probably damaging 0.99
R4677:Trcg1 UTSW 9 57245861 missense possibly damaging 0.94
R4879:Trcg1 UTSW 9 57246720 missense probably damaging 0.99
R5013:Trcg1 UTSW 9 57242279 missense probably damaging 0.99
R5141:Trcg1 UTSW 9 57241304 missense probably damaging 1.00
R5690:Trcg1 UTSW 9 57241811 missense probably benign 0.36
R6416:Trcg1 UTSW 9 57241330 missense possibly damaging 0.46
R6980:Trcg1 UTSW 9 57245573 missense probably damaging 0.99
R7022:Trcg1 UTSW 9 57241569 missense possibly damaging 0.46
R7172:Trcg1 UTSW 9 57248335 missense probably benign 0.01
R7276:Trcg1 UTSW 9 57242579 missense probably damaging 0.99
R7412:Trcg1 UTSW 9 57241483 missense probably benign 0.00
R7546:Trcg1 UTSW 9 57248338 missense probably benign 0.34
R7942:Trcg1 UTSW 9 57242216 missense probably benign
R8087:Trcg1 UTSW 9 57248674 missense probably damaging 0.99
R8094:Trcg1 UTSW 9 57242281 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTACTGGGCATCCTGACAG -3'
(R):5'- ATGCCAAGCTGGTTTAGATGC -3'

Sequencing Primer
(F):5'- AGACGTCACTGGTGGTATCAACTC -3'
(R):5'- CTCCAGTGTTTCAGAGGCAG -3'
Posted On 2021-07-15