Incidental Mutation 'R8826:Nlrp12'
ID 673449
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene Name NLR family, pyrin domain containing 12
Synonyms Nalp12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R8826 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 3218784-3249740 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3240991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 297 (D297G)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
AlphaFold E9Q5R7
Predicted Effect possibly damaging
Transcript: ENSMUST00000108653
AA Change: D297G

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: D297G

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Meta Mutation Damage Score 0.5498 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta1 T C 8: 123,893,239 M121V probably damaging Het
AF529169 T A 9: 89,601,181 E721V probably damaging Het
AI987944 A T 7: 41,375,203 H120Q possibly damaging Het
Aldh9a1 C G 1: 167,356,550 P205A probably damaging Het
Ank2 A T 3: 126,947,302 N1644K unknown Het
Arfgef2 A T 2: 166,835,466 probably benign Het
Bpifb4 G T 2: 153,941,897 V54L probably benign Het
Cacna1c T A 6: 118,734,875 M456L Het
Cbln1 T C 8: 87,471,792 N95S probably benign Het
Ccl11 G T 11: 82,062,218 R67S possibly damaging Het
Cd200 G A 16: 45,394,794 R165C probably benign Het
Cd2bp2 A T 7: 127,194,085 M283K probably damaging Het
Cd86 G T 16: 36,615,288 L256I possibly damaging Het
Ces2f T A 8: 104,953,102 F409Y probably benign Het
Cisd3 A T 11: 97,688,332 Q100L probably damaging Het
Cntnap1 C T 11: 101,186,829 R1106C probably damaging Het
Col6a2 A T 10: 76,603,599 M777K probably damaging Het
Cp A G 3: 19,985,575 Y852C probably damaging Het
D3Ertd254e T C 3: 36,164,106 Y93H possibly damaging Het
Ddx1 T C 12: 13,227,331 E523G probably damaging Het
Ddx60 T A 8: 61,945,956 D236E probably benign Het
Dgcr14 A T 16: 17,905,090 M320K probably damaging Het
Dnah9 A T 11: 65,849,916 F4148Y probably benign Het
Dusp6 G T 10: 99,263,607 probably benign Het
Eif2a C A 3: 58,548,628 Y349* probably null Het
Enpep G A 3: 129,271,418 T874I probably damaging Het
Eps15 A G 4: 109,312,308 D105G possibly damaging Het
Exosc10 G A 4: 148,568,702 probably null Het
Fam13b A T 18: 34,498,017 N36K probably damaging Het
Fanca T C 8: 123,268,470 D1431G probably benign Het
Fgg A G 3: 83,014,318 D436G probably benign Het
Fip1l1 C T 5: 74,564,527 T251I probably benign Het
Galnt2 A G 8: 124,305,608 N104S probably damaging Het
Gm4869 A G 5: 140,469,679 M347V probably damaging Het
Gmip T C 8: 69,816,098 S458P possibly damaging Het
Herc2 A G 7: 56,106,396 D728G probably benign Het
Hif3a A G 7: 17,054,746 L100P probably damaging Het
Hmox2 C G 16: 4,766,002 P282R possibly damaging Het
Hook1 A T 4: 95,992,195 H90L probably benign Het
Igf2bp2 C A 16: 22,065,116 G473C probably damaging Het
Ip6k2 T C 9: 108,798,180 probably null Het
Ipo5 G T 14: 120,919,954 R68L probably damaging Het
Klhdc1 G T 12: 69,258,618 W234L probably damaging Het
Krt8 A G 15: 102,001,435 V178A possibly damaging Het
Lgi3 T A 14: 70,531,272 probably null Het
Litaf T G 16: 10,966,557 N30H probably benign Het
Lman2 C A 13: 55,362,555 W12L unknown Het
Macf1 A G 4: 123,382,229 L6182P probably damaging Het
Magi3 A T 3: 104,085,346 M270K probably benign Het
Mapre2 A T 18: 23,753,831 probably benign Het
Mllt10 T A 2: 18,162,542 V426D probably benign Het
Mrgprf A G 7: 145,308,309 I203V probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Mrpl24 C T 3: 87,922,394 R96* probably null Het
Nbas T A 12: 13,352,874 probably benign Het
Nipal4 G A 11: 46,154,643 T131M possibly damaging Het
Nol6 A C 4: 41,121,823 M237R probably benign Het
Olfr348 T A 2: 36,786,843 L106* probably null Het
Olig1 A G 16: 91,270,139 E88G probably benign Het
Parg A G 14: 32,209,218 D265G possibly damaging Het
Pcdhgb8 A T 18: 37,762,248 I124L probably damaging Het
Pign A G 1: 105,554,102 F822L probably damaging Het
Plch2 T C 4: 154,986,683 T1080A probably benign Het
Pld4 A T 12: 112,766,776 Y262F possibly damaging Het
Ppp1r12b A G 1: 134,765,992 V977A probably benign Het
Ppp6r3 C T 19: 3,471,984 E565K Het
Psmg2 A G 18: 67,654,088 probably benign Het
Ptcd3 C T 6: 71,908,661 G27D probably benign Het
Retreg2 G T 1: 75,142,881 G7C unknown Het
Rlbp1 A T 7: 79,377,366 F182Y probably benign Het
Rnf148 G C 6: 23,654,379 S206C probably benign Het
Sash1 A G 10: 8,762,105 M1T probably null Het
Shank3 A T 15: 89,549,395 T1448S probably damaging Het
Sipa1l1 A G 12: 82,342,433 K478E probably damaging Het
Slitrk6 A G 14: 110,751,369 I302T probably benign Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Sncaip A T 18: 52,915,309 H939L probably benign Het
Stn1 T C 19: 47,536,270 D27G probably damaging Het
Sugct T G 13: 17,252,595 probably null Het
Tmem259 A G 10: 79,979,149 S214P probably damaging Het
Trdv4 G A 14: 54,075,489 G107S probably damaging Het
Ttc3 C T 16: 94,431,970 L957F possibly damaging Het
Ttn A G 2: 76,881,127 Y8357H unknown Het
Twnk T C 19: 45,007,995 V289A probably benign Het
Umodl1 A G 17: 30,983,984 D437G possibly damaging Het
Upf1 T C 8: 70,338,280 T590A probably benign Het
Vmn2r63 A T 7: 42,927,017 D457E probably benign Het
Wdr82 A T 9: 106,184,776 T213S probably benign Het
Zfp672 A T 11: 58,329,764 M3K unknown Het
Zfyve26 A G 12: 79,238,968 V2345A probably benign Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3241433 missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3228417 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3240442 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3241373 missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3219259 utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3240683 missense probably benign 0.03
R6957:Nlrp12 UTSW 7 3222486 missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3228388 critical splice donor site probably null
R7793:Nlrp12 UTSW 7 3245400 missense probably benign
R8257:Nlrp12 UTSW 7 3249332 missense probably damaging 1.00
R8357:Nlrp12 UTSW 7 3240805 missense probably damaging 1.00
R8457:Nlrp12 UTSW 7 3240805 missense probably damaging 1.00
R8558:Nlrp12 UTSW 7 3249481 missense probably damaging 1.00
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1176:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1177:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTAGCTTCCTCGGAGAAG -3'
(R):5'- CAAAGTGATGTTGGACTGGGCC -3'

Sequencing Primer
(F):5'- CTGGGGTGTTCTAGCAAGCC -3'
(R):5'- TGGGAGGCTCTTCCAAGG -3'
Posted On 2021-07-15