Incidental Mutation 'R8826:Ddx60'
ID 673457
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R8826 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 61928087-62038244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61945956 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 236 (D236E)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398]
AlphaFold E9PZQ1
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: D236E

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: D236E

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
AA Change: D236E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: D236E

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154398
AA Change: D236E

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921
AA Change: D236E

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (91/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta1 T C 8: 123,893,239 M121V probably damaging Het
AF529169 T A 9: 89,601,181 E721V probably damaging Het
AI987944 A T 7: 41,375,203 H120Q possibly damaging Het
Aldh9a1 C G 1: 167,356,550 P205A probably damaging Het
Ank2 A T 3: 126,947,302 N1644K unknown Het
Arfgef2 A T 2: 166,835,466 probably benign Het
Bpifb4 G T 2: 153,941,897 V54L probably benign Het
Cacna1c T A 6: 118,734,875 M456L Het
Cbln1 T C 8: 87,471,792 N95S probably benign Het
Ccl11 G T 11: 82,062,218 R67S possibly damaging Het
Cd200 G A 16: 45,394,794 R165C probably benign Het
Cd2bp2 A T 7: 127,194,085 M283K probably damaging Het
Cd86 G T 16: 36,615,288 L256I possibly damaging Het
Ces2f T A 8: 104,953,102 F409Y probably benign Het
Cisd3 A T 11: 97,688,332 Q100L probably damaging Het
Cntnap1 C T 11: 101,186,829 R1106C probably damaging Het
Col6a2 A T 10: 76,603,599 M777K probably damaging Het
Cp A G 3: 19,985,575 Y852C probably damaging Het
D3Ertd254e T C 3: 36,164,106 Y93H possibly damaging Het
Ddx1 T C 12: 13,227,331 E523G probably damaging Het
Dgcr14 A T 16: 17,905,090 M320K probably damaging Het
Dnah9 A T 11: 65,849,916 F4148Y probably benign Het
Dusp6 G T 10: 99,263,607 probably benign Het
Eif2a C A 3: 58,548,628 Y349* probably null Het
Enpep G A 3: 129,271,418 T874I probably damaging Het
Eps15 A G 4: 109,312,308 D105G possibly damaging Het
Exosc10 G A 4: 148,568,702 probably null Het
Fam13b A T 18: 34,498,017 N36K probably damaging Het
Fanca T C 8: 123,268,470 D1431G probably benign Het
Fgg A G 3: 83,014,318 D436G probably benign Het
Fip1l1 C T 5: 74,564,527 T251I probably benign Het
Galnt2 A G 8: 124,305,608 N104S probably damaging Het
Gm4869 A G 5: 140,469,679 M347V probably damaging Het
Gmip T C 8: 69,816,098 S458P possibly damaging Het
Herc2 A G 7: 56,106,396 D728G probably benign Het
Hif3a A G 7: 17,054,746 L100P probably damaging Het
Hmox2 C G 16: 4,766,002 P282R possibly damaging Het
Hook1 A T 4: 95,992,195 H90L probably benign Het
Igf2bp2 C A 16: 22,065,116 G473C probably damaging Het
Ip6k2 T C 9: 108,798,180 probably null Het
Ipo5 G T 14: 120,919,954 R68L probably damaging Het
Klhdc1 G T 12: 69,258,618 W234L probably damaging Het
Krt8 A G 15: 102,001,435 V178A possibly damaging Het
Lgi3 T A 14: 70,531,272 probably null Het
Litaf T G 16: 10,966,557 N30H probably benign Het
Lman2 C A 13: 55,362,555 W12L unknown Het
Macf1 A G 4: 123,382,229 L6182P probably damaging Het
Magi3 A T 3: 104,085,346 M270K probably benign Het
Mapre2 A T 18: 23,753,831 probably benign Het
Mllt10 T A 2: 18,162,542 V426D probably benign Het
Mrgprf A G 7: 145,308,309 I203V probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Mrpl24 C T 3: 87,922,394 R96* probably null Het
Nbas T A 12: 13,352,874 probably benign Het
Nipal4 G A 11: 46,154,643 T131M possibly damaging Het
Nlrp12 T C 7: 3,240,991 D297G possibly damaging Het
Nol6 A C 4: 41,121,823 M237R probably benign Het
Olfr348 T A 2: 36,786,843 L106* probably null Het
Olig1 A G 16: 91,270,139 E88G probably benign Het
Parg A G 14: 32,209,218 D265G possibly damaging Het
Pcdhgb8 A T 18: 37,762,248 I124L probably damaging Het
Pign A G 1: 105,554,102 F822L probably damaging Het
Plch2 T C 4: 154,986,683 T1080A probably benign Het
Pld4 A T 12: 112,766,776 Y262F possibly damaging Het
Ppp1r12b A G 1: 134,765,992 V977A probably benign Het
Ppp6r3 C T 19: 3,471,984 E565K Het
Psmg2 A G 18: 67,654,088 probably benign Het
Ptcd3 C T 6: 71,908,661 G27D probably benign Het
Retreg2 G T 1: 75,142,881 G7C unknown Het
Rlbp1 A T 7: 79,377,366 F182Y probably benign Het
Rnf148 G C 6: 23,654,379 S206C probably benign Het
Sash1 A G 10: 8,762,105 M1T probably null Het
Shank3 A T 15: 89,549,395 T1448S probably damaging Het
Sipa1l1 A G 12: 82,342,433 K478E probably damaging Het
Slitrk6 A G 14: 110,751,369 I302T probably benign Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Sncaip A T 18: 52,915,309 H939L probably benign Het
Stn1 T C 19: 47,536,270 D27G probably damaging Het
Sugct T G 13: 17,252,595 probably null Het
Tmem259 A G 10: 79,979,149 S214P probably damaging Het
Trdv4 G A 14: 54,075,489 G107S probably damaging Het
Ttc3 C T 16: 94,431,970 L957F possibly damaging Het
Ttn A G 2: 76,881,127 Y8357H unknown Het
Twnk T C 19: 45,007,995 V289A probably benign Het
Umodl1 A G 17: 30,983,984 D437G possibly damaging Het
Upf1 T C 8: 70,338,280 T590A probably benign Het
Vmn2r63 A T 7: 42,927,017 D457E probably benign Het
Wdr82 A T 9: 106,184,776 T213S probably benign Het
Zfp672 A T 11: 58,329,764 M3K unknown Het
Zfyve26 A G 12: 79,238,968 V2345A probably benign Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
Scatter UTSW 8 62021314 missense possibly damaging 0.80
shotgun UTSW 8 62037067 missense probably benign 0.28
splay UTSW 8 62021309 missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62000597 missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61974150 missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61958606 missense probably benign 0.27
R8829:Ddx60 UTSW 8 61940661 missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62021309 missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 61994519 missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 61974134 nonsense probably null
R9122:Ddx60 UTSW 8 61989864 missense probably benign 0.16
R9225:Ddx60 UTSW 8 62017841 missense probably benign 0.36
R9278:Ddx60 UTSW 8 61977978 missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62009960 missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 61972214 missense probably benign 0.03
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATTGAGAACTGCTTTGTAACGTGAG -3'
(R):5'- AAACCCTGGAAGATGGCTG -3'

Sequencing Primer
(F):5'- ACGTGAGTTTACCTTAAATTTCTGAG -3'
(R):5'- CCTGGAAGATGGCTGGTCTCAAG -3'
Posted On 2021-07-15