Incidental Mutation 'R8826:Upf1'
ID 673459
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, PNORF-1, Rent1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock # R8826 (G1)
Quality Score 222.009
Status Validated
Chromosome 8
Chromosomal Location 70331525-70353278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70338280 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 590 (T590A)
Ref Sequence ENSEMBL: ENSMUSP00000075089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect probably benign
Transcript: ENSMUST00000075666
AA Change: T590A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: T590A

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215817
AA Change: T579A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta1 T C 8: 123,893,239 M121V probably damaging Het
AF529169 T A 9: 89,601,181 E721V probably damaging Het
AI987944 A T 7: 41,375,203 H120Q possibly damaging Het
Aldh9a1 C G 1: 167,356,550 P205A probably damaging Het
Ank2 A T 3: 126,947,302 N1644K unknown Het
Arfgef2 A T 2: 166,835,466 probably benign Het
Bpifb4 G T 2: 153,941,897 V54L probably benign Het
Cacna1c T A 6: 118,734,875 M456L Het
Cbln1 T C 8: 87,471,792 N95S probably benign Het
Ccl11 G T 11: 82,062,218 R67S possibly damaging Het
Cd200 G A 16: 45,394,794 R165C probably benign Het
Cd2bp2 A T 7: 127,194,085 M283K probably damaging Het
Cd86 G T 16: 36,615,288 L256I possibly damaging Het
Ces2f T A 8: 104,953,102 F409Y probably benign Het
Cisd3 A T 11: 97,688,332 Q100L probably damaging Het
Cntnap1 C T 11: 101,186,829 R1106C probably damaging Het
Col6a2 A T 10: 76,603,599 M777K probably damaging Het
Cp A G 3: 19,985,575 Y852C probably damaging Het
D3Ertd254e T C 3: 36,164,106 Y93H possibly damaging Het
Ddx1 T C 12: 13,227,331 E523G probably damaging Het
Ddx60 T A 8: 61,945,956 D236E probably benign Het
Dgcr14 A T 16: 17,905,090 M320K probably damaging Het
Dnah9 A T 11: 65,849,916 F4148Y probably benign Het
Dusp6 G T 10: 99,263,607 probably benign Het
Eif2a C A 3: 58,548,628 Y349* probably null Het
Enpep G A 3: 129,271,418 T874I probably damaging Het
Eps15 A G 4: 109,312,308 D105G possibly damaging Het
Exosc10 G A 4: 148,568,702 probably null Het
Fam13b A T 18: 34,498,017 N36K probably damaging Het
Fanca T C 8: 123,268,470 D1431G probably benign Het
Fgg A G 3: 83,014,318 D436G probably benign Het
Fip1l1 C T 5: 74,564,527 T251I probably benign Het
Galnt2 A G 8: 124,305,608 N104S probably damaging Het
Gm4869 A G 5: 140,469,679 M347V probably damaging Het
Gmip T C 8: 69,816,098 S458P possibly damaging Het
Herc2 A G 7: 56,106,396 D728G probably benign Het
Hif3a A G 7: 17,054,746 L100P probably damaging Het
Hmox2 C G 16: 4,766,002 P282R possibly damaging Het
Hook1 A T 4: 95,992,195 H90L probably benign Het
Igf2bp2 C A 16: 22,065,116 G473C probably damaging Het
Ip6k2 T C 9: 108,798,180 probably null Het
Ipo5 G T 14: 120,919,954 R68L probably damaging Het
Klhdc1 G T 12: 69,258,618 W234L probably damaging Het
Krt8 A G 15: 102,001,435 V178A possibly damaging Het
Lgi3 T A 14: 70,531,272 probably null Het
Litaf T G 16: 10,966,557 N30H probably benign Het
Lman2 C A 13: 55,362,555 W12L unknown Het
Macf1 A G 4: 123,382,229 L6182P probably damaging Het
Magi3 A T 3: 104,085,346 M270K probably benign Het
Mapre2 A T 18: 23,753,831 probably benign Het
Mllt10 T A 2: 18,162,542 V426D probably benign Het
Mrgprf A G 7: 145,308,309 I203V probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Mrpl24 C T 3: 87,922,394 R96* probably null Het
Nbas T A 12: 13,352,874 probably benign Het
Nipal4 G A 11: 46,154,643 T131M possibly damaging Het
Nlrp12 T C 7: 3,240,991 D297G possibly damaging Het
Nol6 A C 4: 41,121,823 M237R probably benign Het
Olfr348 T A 2: 36,786,843 L106* probably null Het
Olig1 A G 16: 91,270,139 E88G probably benign Het
Parg A G 14: 32,209,218 D265G possibly damaging Het
Pcdhgb8 A T 18: 37,762,248 I124L probably damaging Het
Pign A G 1: 105,554,102 F822L probably damaging Het
Plch2 T C 4: 154,986,683 T1080A probably benign Het
Pld4 A T 12: 112,766,776 Y262F possibly damaging Het
Ppp1r12b A G 1: 134,765,992 V977A probably benign Het
Ppp6r3 C T 19: 3,471,984 E565K Het
Psmg2 A G 18: 67,654,088 probably benign Het
Ptcd3 C T 6: 71,908,661 G27D probably benign Het
Retreg2 G T 1: 75,142,881 G7C unknown Het
Rlbp1 A T 7: 79,377,366 F182Y probably benign Het
Rnf148 G C 6: 23,654,379 S206C probably benign Het
Sash1 A G 10: 8,762,105 M1T probably null Het
Shank3 A T 15: 89,549,395 T1448S probably damaging Het
Sipa1l1 A G 12: 82,342,433 K478E probably damaging Het
Slitrk6 A G 14: 110,751,369 I302T probably benign Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Sncaip A T 18: 52,915,309 H939L probably benign Het
Stn1 T C 19: 47,536,270 D27G probably damaging Het
Sugct T G 13: 17,252,595 probably null Het
Tmem259 A G 10: 79,979,149 S214P probably damaging Het
Trdv4 G A 14: 54,075,489 G107S probably damaging Het
Ttc3 C T 16: 94,431,970 L957F possibly damaging Het
Ttn A G 2: 76,881,127 Y8357H unknown Het
Twnk T C 19: 45,007,995 V289A probably benign Het
Umodl1 A G 17: 30,983,984 D437G possibly damaging Het
Vmn2r63 A T 7: 42,927,017 D457E probably benign Het
Wdr82 A T 9: 106,184,776 T213S probably benign Het
Zfp672 A T 11: 58,329,764 M3K unknown Het
Zfyve26 A G 12: 79,238,968 V2345A probably benign Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70338284 missense probably benign
IGL01890:Upf1 APN 8 70334230 missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70335652 critical splice donor site probably null
IGL03142:Upf1 APN 8 70333327 missense probably benign 0.04
IGL03151:Upf1 APN 8 70335387 missense probably damaging 0.98
Nanosphere UTSW 8 70344262 missense probably benign 0.01
Particulate UTSW 8 70337025 missense probably damaging 0.96
R0270:Upf1 UTSW 8 70335645 splice site probably benign
R0477:Upf1 UTSW 8 70334080 missense probably benign
R0755:Upf1 UTSW 8 70334129 missense probably benign 0.01
R1018:Upf1 UTSW 8 70338906 missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70338403 missense probably damaging 0.98
R1445:Upf1 UTSW 8 70341524 missense probably benign 0.00
R1458:Upf1 UTSW 8 70344254 missense probably benign 0.00
R1511:Upf1 UTSW 8 70338505 missense probably damaging 0.99
R1552:Upf1 UTSW 8 70333059 nonsense probably null
R1560:Upf1 UTSW 8 70338442 missense probably damaging 1.00
R1562:Upf1 UTSW 8 70343367 nonsense probably null
R2082:Upf1 UTSW 8 70341572 missense probably damaging 1.00
R2143:Upf1 UTSW 8 70339354 missense probably null 1.00
R2423:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R2425:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3031:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3032:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3123:Upf1 UTSW 8 70337483 splice site probably benign
R3508:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3747:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70339814 missense probably benign 0.30
R3964:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3965:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4152:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4505:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4506:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4838:Upf1 UTSW 8 70339368 missense probably benign 0.03
R5001:Upf1 UTSW 8 70334700 missense probably damaging 1.00
R5715:Upf1 UTSW 8 70352978 missense probably damaging 0.96
R5748:Upf1 UTSW 8 70338517 missense probably damaging 1.00
R5856:Upf1 UTSW 8 70334762 critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70344262 missense probably benign 0.01
R6010:Upf1 UTSW 8 70337025 missense probably damaging 0.96
R6056:Upf1 UTSW 8 70333037 missense probably damaging 0.98
R6870:Upf1 UTSW 8 70341561 missense probably benign 0.11
R7205:Upf1 UTSW 8 70340045 missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70340618 missense probably damaging 1.00
R7464:Upf1 UTSW 8 70333423 missense probably benign
R7759:Upf1 UTSW 8 70334080 missense probably benign
R7783:Upf1 UTSW 8 70352858 missense probably benign 0.11
R8079:Upf1 UTSW 8 70338884 critical splice donor site probably null
R8192:Upf1 UTSW 8 70340644 missense probably benign 0.03
R8544:Upf1 UTSW 8 70337052 missense probably damaging 1.00
R8738:Upf1 UTSW 8 70333322 missense probably benign 0.01
R8738:Upf1 UTSW 8 70333323 missense probably benign 0.06
R8876:Upf1 UTSW 8 70344268 missense possibly damaging 0.92
R8906:Upf1 UTSW 8 70334165 nonsense probably null
R8911:Upf1 UTSW 8 70338437 missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70340024 missense probably benign
R9425:Upf1 UTSW 8 70339353 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGACATGCTACCAGGCTTCTG -3'
(R):5'- ATCCACCAGACAGGACTGAAGG -3'

Sequencing Primer
(F):5'- GGCTTCTGACTCGAACAGAC -3'
(R):5'- ACTGAAGGTCGTACGCCTCTG -3'
Posted On 2021-07-15