Incidental Mutation 'R8826:Galnt2'
ID673464
Institutional Source Beutler Lab
Gene Symbol Galnt2
Ensembl Gene ENSMUSG00000089704
Gene Namepolypeptide N-acetylgalactosaminyltransferase 2
SynonymsppGaNTase-T2
Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R8826 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location124231391-124345724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124305608 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 104 (N104S)
Ref Sequence ENSEMBL: ENSMUSP00000034458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000034458
AA Change: N104S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: N104S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glycos_transf_2 138 321 8.3e-31 PFAM
Pfam:Glyco_transf_7C 295 365 5.4e-8 PFAM
RICIN 440 565 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127664
AA Change: N70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: N70S

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI

None

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta1 T C 8: 123,893,239 M121V probably damaging Het
AF529169 T A 9: 89,601,181 E721V probably damaging Het
AI987944 A T 7: 41,375,203 H120Q possibly damaging Het
Aldh9a1 C G 1: 167,356,550 P205A probably damaging Het
Ank2 A T 3: 126,947,302 N1644K unknown Het
Bpifb4 G T 2: 153,941,897 V54L probably benign Het
Cacna1c T A 6: 118,734,875 M456L Het
Cbln1 T C 8: 87,471,792 N95S probably benign Het
Ccl11 G T 11: 82,062,218 R67S possibly damaging Het
Cd200 G A 16: 45,394,794 R165C probably benign Het
Cd2bp2 A T 7: 127,194,085 M283K probably damaging Het
Cd86 G T 16: 36,615,288 L256I possibly damaging Het
Ces2f T A 8: 104,953,102 F409Y probably benign Het
Cisd3 A T 11: 97,688,332 Q100L probably damaging Het
Cntnap1 C T 11: 101,186,829 R1106C probably damaging Het
Col6a2 A T 10: 76,603,599 M777K probably damaging Het
Cp A G 3: 19,985,575 Y852C probably damaging Het
D3Ertd254e T C 3: 36,164,106 Y93H possibly damaging Het
Ddx1 T C 12: 13,227,331 E523G probably damaging Het
Ddx60 T A 8: 61,945,956 D236E probably benign Het
Dgcr14 A T 16: 17,905,090 M320K probably damaging Het
Dnah9 A T 11: 65,849,916 F4148Y probably benign Het
Dusp6 G T 10: 99,263,607 probably benign Het
Eif2a C A 3: 58,548,628 Y349* probably null Het
Enpep G A 3: 129,271,418 T874I probably damaging Het
Eps15 A G 4: 109,312,308 D105G possibly damaging Het
Exosc10 G A 4: 148,568,702 probably null Het
Fam13b A T 18: 34,498,017 N36K probably damaging Het
Fanca T C 8: 123,268,470 D1431G probably benign Het
Fgg A G 3: 83,014,318 D436G probably benign Het
Fip1l1 C T 5: 74,564,527 T251I probably benign Het
Gm4869 A G 5: 140,469,679 M347V probably damaging Het
Gmip T C 8: 69,816,098 S458P possibly damaging Het
Herc2 A G 7: 56,106,396 D728G probably benign Het
Hif3a A G 7: 17,054,746 L100P probably damaging Het
Hmox2 C G 16: 4,766,002 P282R possibly damaging Het
Hook1 A T 4: 95,992,195 H90L probably benign Het
Igf2bp2 C A 16: 22,065,116 G473C probably damaging Het
Ip6k2 T C 9: 108,798,180 probably null Het
Ipo5 G T 14: 120,919,954 R68L probably damaging Het
Klhdc1 G T 12: 69,258,618 W234L probably damaging Het
Krt8 A G 15: 102,001,435 V178A possibly damaging Het
Lgi3 T A 14: 70,531,272 probably null Het
Litaf T G 16: 10,966,557 N30H probably benign Het
Lman2 C A 13: 55,362,555 W12L unknown Het
Macf1 A G 4: 123,382,229 L6182P probably damaging Het
Magi3 A T 3: 104,085,346 M270K probably benign Het
Mapre2 A T 18: 23,753,831 probably benign Het
Mllt10 T A 2: 18,162,542 V426D probably benign Het
Mrgprf A G 7: 145,308,309 I203V probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Mrpl24 C T 3: 87,922,394 R96* probably null Het
Nipal4 G A 11: 46,154,643 T131M possibly damaging Het
Nlrp12 T C 7: 3,240,991 D297G possibly damaging Het
Nol6 A C 4: 41,121,823 M237R probably benign Het
Olfr348 T A 2: 36,786,843 L106* probably null Het
Olig1 A G 16: 91,270,139 E88G probably benign Het
Parg A G 14: 32,209,218 D265G possibly damaging Het
Pcdhgb8 A T 18: 37,762,248 I124L probably damaging Het
Pign A G 1: 105,554,102 F822L probably damaging Het
Plch2 T C 4: 154,986,683 T1080A probably benign Het
Pld4 A T 12: 112,766,776 Y262F possibly damaging Het
Ppp1r12b A G 1: 134,765,992 V977A probably benign Het
Ppp6r3 C T 19: 3,471,984 E565K Het
Ptcd3 C T 6: 71,908,661 G27D probably benign Het
Rlbp1 A T 7: 79,377,366 F182Y probably benign Het
Rnf148 G C 6: 23,654,379 S206C probably benign Het
Sash1 A G 10: 8,762,105 M1T probably null Het
Shank3 A T 15: 89,549,395 T1448S probably damaging Het
Sipa1l1 A G 12: 82,342,433 K478E probably damaging Het
Slitrk6 A G 14: 110,751,369 I302T probably benign Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Sncaip A T 18: 52,915,309 H939L probably benign Het
Stn1 T C 19: 47,536,270 D27G probably damaging Het
Sugct T G 13: 17,252,595 probably null Het
Tmem259 A G 10: 79,979,149 S214P probably damaging Het
Trdv4 G A 14: 54,075,489 G107S probably damaging Het
Ttc3 C T 16: 94,431,970 L957F possibly damaging Het
Ttn A G 2: 76,881,127 Y8357H unknown Het
Twnk T C 19: 45,007,995 V289A probably benign Het
Umodl1 A G 17: 30,983,984 D437G possibly damaging Het
Upf1 T C 8: 70,338,280 T590A probably benign Het
Vmn2r63 A T 7: 42,927,017 D457E probably benign Het
Wdr82 A T 9: 106,184,776 T213S probably benign Het
Zfp672 A T 11: 58,329,764 M3K Het
Zfyve26 A G 12: 79,238,968 V2345A probably benign Het
Other mutations in Galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Galnt2 APN 8 124305506 splice site probably benign
IGL02638:Galnt2 APN 8 124231579 missense probably damaging 0.98
chivalry UTSW 8 124334286 nonsense probably null
gallantry UTSW 8 124340822 missense probably damaging 1.00
valor UTSW 8 124329788 missense probably damaging 1.00
P0018:Galnt2 UTSW 8 124336611 missense probably damaging 1.00
R0133:Galnt2 UTSW 8 124338538 missense probably benign 0.19
R0453:Galnt2 UTSW 8 124338584 splice site probably benign
R0709:Galnt2 UTSW 8 124343346 missense probably benign 0.01
R1015:Galnt2 UTSW 8 124336617 missense probably benign
R4388:Galnt2 UTSW 8 124295453 critical splice donor site probably null
R4400:Galnt2 UTSW 8 124324303 missense probably damaging 1.00
R4447:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4448:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4449:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4450:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4927:Galnt2 UTSW 8 124305623 missense probably damaging 1.00
R5536:Galnt2 UTSW 8 124323673 missense probably damaging 1.00
R6218:Galnt2 UTSW 8 124343315 missense probably benign 0.01
R6732:Galnt2 UTSW 8 124340822 missense probably damaging 1.00
R6795:Galnt2 UTSW 8 124343436 missense probably damaging 1.00
R6823:Galnt2 UTSW 8 124324011 missense probably benign
R7173:Galnt2 UTSW 8 124305553 missense probably benign 0.00
R7479:Galnt2 UTSW 8 124334338 missense probably damaging 1.00
R7818:Galnt2 UTSW 8 124329788 missense probably damaging 1.00
R7821:Galnt2 UTSW 8 124343395 missense possibly damaging 0.51
R7831:Galnt2 UTSW 8 124332078 missense probably benign 0.04
R8348:Galnt2 UTSW 8 124334286 nonsense probably null
R8770:Galnt2 UTSW 8 124334286 nonsense probably null
X0024:Galnt2 UTSW 8 124343345 missense probably benign 0.28
Z1177:Galnt2 UTSW 8 124343318 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACAGTTGTCCTCCTGTGAACG -3'
(R):5'- AAGAGCCATGAGCCTCACTC -3'

Sequencing Primer
(F):5'- TCCTCCTGTGAACGAGCCAAG -3'
(R):5'- ACTCACTCCAGGATGTTGC -3'
Posted On2021-07-15