Incidental Mutation 'R8826:Krt8'
ID 673493
Institutional Source Beutler Lab
Gene Symbol Krt8
Ensembl Gene ENSMUSG00000049382
Gene Name keratin 8
Synonyms Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8826 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101996698-102004482 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102001435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 178 (V178A)
Ref Sequence ENSEMBL: ENSMUSP00000023952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023952]
AlphaFold P11679
Predicted Effect possibly damaging
Transcript: ENSMUST00000023952
AA Change: V178A

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: V178A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 93 9.4e-18 PFAM
Filament 96 407 7.82e-188 SMART
low complexity region 421 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta1 T C 8: 123,893,239 M121V probably damaging Het
AF529169 T A 9: 89,601,181 E721V probably damaging Het
AI987944 A T 7: 41,375,203 H120Q possibly damaging Het
Aldh9a1 C G 1: 167,356,550 P205A probably damaging Het
Ank2 A T 3: 126,947,302 N1644K unknown Het
Arfgef2 A T 2: 166,835,466 probably benign Het
Bpifb4 G T 2: 153,941,897 V54L probably benign Het
Cacna1c T A 6: 118,734,875 M456L Het
Cbln1 T C 8: 87,471,792 N95S probably benign Het
Ccl11 G T 11: 82,062,218 R67S possibly damaging Het
Cd200 G A 16: 45,394,794 R165C probably benign Het
Cd2bp2 A T 7: 127,194,085 M283K probably damaging Het
Cd86 G T 16: 36,615,288 L256I possibly damaging Het
Ces2f T A 8: 104,953,102 F409Y probably benign Het
Cisd3 A T 11: 97,688,332 Q100L probably damaging Het
Cntnap1 C T 11: 101,186,829 R1106C probably damaging Het
Col6a2 A T 10: 76,603,599 M777K probably damaging Het
Cp A G 3: 19,985,575 Y852C probably damaging Het
D3Ertd254e T C 3: 36,164,106 Y93H possibly damaging Het
Ddx1 T C 12: 13,227,331 E523G probably damaging Het
Ddx60 T A 8: 61,945,956 D236E probably benign Het
Dgcr14 A T 16: 17,905,090 M320K probably damaging Het
Dnah9 A T 11: 65,849,916 F4148Y probably benign Het
Dusp6 G T 10: 99,263,607 probably benign Het
Eif2a C A 3: 58,548,628 Y349* probably null Het
Enpep G A 3: 129,271,418 T874I probably damaging Het
Eps15 A G 4: 109,312,308 D105G possibly damaging Het
Exosc10 G A 4: 148,568,702 probably null Het
Fam13b A T 18: 34,498,017 N36K probably damaging Het
Fanca T C 8: 123,268,470 D1431G probably benign Het
Fgg A G 3: 83,014,318 D436G probably benign Het
Fip1l1 C T 5: 74,564,527 T251I probably benign Het
Galnt2 A G 8: 124,305,608 N104S probably damaging Het
Gm4869 A G 5: 140,469,679 M347V probably damaging Het
Gmip T C 8: 69,816,098 S458P possibly damaging Het
Herc2 A G 7: 56,106,396 D728G probably benign Het
Hif3a A G 7: 17,054,746 L100P probably damaging Het
Hmox2 C G 16: 4,766,002 P282R possibly damaging Het
Hook1 A T 4: 95,992,195 H90L probably benign Het
Igf2bp2 C A 16: 22,065,116 G473C probably damaging Het
Ip6k2 T C 9: 108,798,180 probably null Het
Ipo5 G T 14: 120,919,954 R68L probably damaging Het
Klhdc1 G T 12: 69,258,618 W234L probably damaging Het
Lgi3 T A 14: 70,531,272 probably null Het
Litaf T G 16: 10,966,557 N30H probably benign Het
Lman2 C A 13: 55,362,555 W12L unknown Het
Macf1 A G 4: 123,382,229 L6182P probably damaging Het
Magi3 A T 3: 104,085,346 M270K probably benign Het
Mapre2 A T 18: 23,753,831 probably benign Het
Mllt10 T A 2: 18,162,542 V426D probably benign Het
Mrgprf A G 7: 145,308,309 I203V probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Mrpl24 C T 3: 87,922,394 R96* probably null Het
Nbas T A 12: 13,352,874 probably benign Het
Nipal4 G A 11: 46,154,643 T131M possibly damaging Het
Nlrp12 T C 7: 3,240,991 D297G possibly damaging Het
Nol6 A C 4: 41,121,823 M237R probably benign Het
Olfr348 T A 2: 36,786,843 L106* probably null Het
Olig1 A G 16: 91,270,139 E88G probably benign Het
Parg A G 14: 32,209,218 D265G possibly damaging Het
Pcdhgb8 A T 18: 37,762,248 I124L probably damaging Het
Pign A G 1: 105,554,102 F822L probably damaging Het
Plch2 T C 4: 154,986,683 T1080A probably benign Het
Pld4 A T 12: 112,766,776 Y262F possibly damaging Het
Ppp1r12b A G 1: 134,765,992 V977A probably benign Het
Ppp6r3 C T 19: 3,471,984 E565K Het
Psmg2 A G 18: 67,654,088 probably benign Het
Ptcd3 C T 6: 71,908,661 G27D probably benign Het
Retreg2 G T 1: 75,142,881 G7C unknown Het
Rlbp1 A T 7: 79,377,366 F182Y probably benign Het
Rnf148 G C 6: 23,654,379 S206C probably benign Het
Sash1 A G 10: 8,762,105 M1T probably null Het
Shank3 A T 15: 89,549,395 T1448S probably damaging Het
Sipa1l1 A G 12: 82,342,433 K478E probably damaging Het
Slitrk6 A G 14: 110,751,369 I302T probably benign Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Sncaip A T 18: 52,915,309 H939L probably benign Het
Stn1 T C 19: 47,536,270 D27G probably damaging Het
Sugct T G 13: 17,252,595 probably null Het
Tmem259 A G 10: 79,979,149 S214P probably damaging Het
Trdv4 G A 14: 54,075,489 G107S probably damaging Het
Ttc3 C T 16: 94,431,970 L957F possibly damaging Het
Ttn A G 2: 76,881,127 Y8357H unknown Het
Twnk T C 19: 45,007,995 V289A probably benign Het
Umodl1 A G 17: 30,983,984 D437G possibly damaging Het
Upf1 T C 8: 70,338,280 T590A probably benign Het
Vmn2r63 A T 7: 42,927,017 D457E probably benign Het
Wdr82 A T 9: 106,184,776 T213S probably benign Het
Zfp672 A T 11: 58,329,764 M3K unknown Het
Zfyve26 A G 12: 79,238,968 V2345A probably benign Het
Other mutations in Krt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Krt8 APN 15 101998025 missense probably benign
IGL01643:Krt8 APN 15 101997073 missense possibly damaging 0.64
IGL01966:Krt8 APN 15 101997670 missense probably benign 0.08
IGL02587:Krt8 APN 15 101998932 missense probably benign 0.04
IGL03088:Krt8 APN 15 102000587 missense possibly damaging 0.90
R0531:Krt8 UTSW 15 102001448 missense probably benign 0.12
R1451:Krt8 UTSW 15 101998829 missense possibly damaging 0.93
R2258:Krt8 UTSW 15 101998822 missense probably benign
R2348:Krt8 UTSW 15 101998865 missense probably benign 0.31
R2566:Krt8 UTSW 15 101998024 missense probably benign 0.03
R3796:Krt8 UTSW 15 101999442 missense probably benign 0.00
R4834:Krt8 UTSW 15 101998821 missense probably damaging 1.00
R4965:Krt8 UTSW 15 101996951 missense probably benign
R5212:Krt8 UTSW 15 101997967 missense possibly damaging 0.52
R5249:Krt8 UTSW 15 101998440 missense possibly damaging 0.69
R5419:Krt8 UTSW 15 102003902 missense probably damaging 0.98
R5778:Krt8 UTSW 15 102003939 missense probably damaging 0.99
R5997:Krt8 UTSW 15 102000594 missense possibly damaging 0.77
R6503:Krt8 UTSW 15 101997934 missense possibly damaging 0.66
R6683:Krt8 UTSW 15 101998004 missense probably benign
R6812:Krt8 UTSW 15 101997979 missense probably damaging 0.99
R6824:Krt8 UTSW 15 101998440 missense possibly damaging 0.50
R6875:Krt8 UTSW 15 101997908 missense probably benign 0.44
R7650:Krt8 UTSW 15 102004163 missense probably benign 0.07
R8047:Krt8 UTSW 15 102003971 missense probably damaging 0.99
R8559:Krt8 UTSW 15 102001544 missense probably benign 0.03
R9146:Krt8 UTSW 15 101998935 missense probably damaging 0.98
Z1177:Krt8 UTSW 15 101999435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGTCCTGGGCTAGACAGTC -3'
(R):5'- GATCCTGACTATAGCCTGATGTG -3'

Sequencing Primer
(F):5'- TCCTGAGACTGAAGCAAAACTG -3'
(R):5'- CTTCCTGGAGCAGCAGAAC -3'
Posted On 2021-07-15