Mutagenetix > Incidental Mutations

Incidental Mutation 'R8826:Krt8'

673493

Institutional Source

Beutler Lab

Gene Symbol

Krt8

Ensembl Gene

ENSMUSG00000049382

Gene Name

keratin 8

Synonyms

Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8826 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101996698-102004482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102001435 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 178 (V178A)

Ref Sequence

ENSEMBL: ENSMUSP00000023952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023952]

AlphaFold

P11679

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023952
AA Change: V178A

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: V178A

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	1	93	9.4e-18	PFAM
Filament	96	407	7.82e-188	SMART
low complexity region	421	438	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta1	T	C	8: 123,893,239	M121V	probably damaging	Het
AF529169	T	A	9: 89,601,181	E721V	probably damaging	Het
AI987944	A	T	7: 41,375,203	H120Q	possibly damaging	Het
Aldh9a1	C	G	1: 167,356,550	P205A	probably damaging	Het
Ank2	A	T	3: 126,947,302	N1644K	unknown	Het
Arfgef2	A	T	2: 166,835,466		probably benign	Het
Bpifb4	G	T	2: 153,941,897	V54L	probably benign	Het
Cacna1c	T	A	6: 118,734,875	M456L		Het
Cbln1	T	C	8: 87,471,792	N95S	probably benign	Het
Ccl11	G	T	11: 82,062,218	R67S	possibly damaging	Het
Cd200	G	A	16: 45,394,794	R165C	probably benign	Het
Cd2bp2	A	T	7: 127,194,085	M283K	probably damaging	Het
Cd86	G	T	16: 36,615,288	L256I	possibly damaging	Het
Ces2f	T	A	8: 104,953,102	F409Y	probably benign	Het
Cisd3	A	T	11: 97,688,332	Q100L	probably damaging	Het
Cntnap1	C	T	11: 101,186,829	R1106C	probably damaging	Het
Col6a2	A	T	10: 76,603,599	M777K	probably damaging	Het
Cp	A	G	3: 19,985,575	Y852C	probably damaging	Het
D3Ertd254e	T	C	3: 36,164,106	Y93H	possibly damaging	Het
Ddx1	T	C	12: 13,227,331	E523G	probably damaging	Het
Ddx60	T	A	8: 61,945,956	D236E	probably benign	Het
Dgcr14	A	T	16: 17,905,090	M320K	probably damaging	Het
Dnah9	A	T	11: 65,849,916	F4148Y	probably benign	Het
Dusp6	G	T	10: 99,263,607		probably benign	Het
Eif2a	C	A	3: 58,548,628	Y349*	probably null	Het
Enpep	G	A	3: 129,271,418	T874I	probably damaging	Het
Eps15	A	G	4: 109,312,308	D105G	possibly damaging	Het
Exosc10	G	A	4: 148,568,702		probably null	Het
Fam13b	A	T	18: 34,498,017	N36K	probably damaging	Het
Fanca	T	C	8: 123,268,470	D1431G	probably benign	Het
Fgg	A	G	3: 83,014,318	D436G	probably benign	Het
Fip1l1	C	T	5: 74,564,527	T251I	probably benign	Het
Galnt2	A	G	8: 124,305,608	N104S	probably damaging	Het
Gm4869	A	G	5: 140,469,679	M347V	probably damaging	Het
Gmip	T	C	8: 69,816,098	S458P	possibly damaging	Het
Herc2	A	G	7: 56,106,396	D728G	probably benign	Het
Hif3a	A	G	7: 17,054,746	L100P	probably damaging	Het
Hmox2	C	G	16: 4,766,002	P282R	possibly damaging	Het
Hook1	A	T	4: 95,992,195	H90L	probably benign	Het
Igf2bp2	C	A	16: 22,065,116	G473C	probably damaging	Het
Ip6k2	T	C	9: 108,798,180		probably null	Het
Ipo5	G	T	14: 120,919,954	R68L	probably damaging	Het
Klhdc1	G	T	12: 69,258,618	W234L	probably damaging	Het
Lgi3	T	A	14: 70,531,272		probably null	Het
Litaf	T	G	16: 10,966,557	N30H	probably benign	Het
Lman2	C	A	13: 55,362,555	W12L	unknown	Het
Macf1	A	G	4: 123,382,229	L6182P	probably damaging	Het
Magi3	A	T	3: 104,085,346	M270K	probably benign	Het
Mapre2	A	T	18: 23,753,831		probably benign	Het
Mllt10	T	A	2: 18,162,542	V426D	probably benign	Het
Mrgprf	A	G	7: 145,308,309	I203V	probably benign	Het
Mrnip	G	A	11: 50,176,861	C27Y	probably damaging	Het
Mrpl24	C	T	3: 87,922,394	R96*	probably null	Het
Nbas	T	A	12: 13,352,874		probably benign	Het
Nipal4	G	A	11: 46,154,643	T131M	possibly damaging	Het
Nlrp12	T	C	7: 3,240,991	D297G	possibly damaging	Het
Nol6	A	C	4: 41,121,823	M237R	probably benign	Het
Olfr348	T	A	2: 36,786,843	L106*	probably null	Het
Olig1	A	G	16: 91,270,139	E88G	probably benign	Het
Parg	A	G	14: 32,209,218	D265G	possibly damaging	Het
Pcdhgb8	A	T	18: 37,762,248	I124L	probably damaging	Het
Pign	A	G	1: 105,554,102	F822L	probably damaging	Het
Plch2	T	C	4: 154,986,683	T1080A	probably benign	Het
Pld4	A	T	12: 112,766,776	Y262F	possibly damaging	Het
Ppp1r12b	A	G	1: 134,765,992	V977A	probably benign	Het
Ppp6r3	C	T	19: 3,471,984	E565K		Het
Psmg2	A	G	18: 67,654,088		probably benign	Het
Ptcd3	C	T	6: 71,908,661	G27D	probably benign	Het
Retreg2	G	T	1: 75,142,881	G7C	unknown	Het
Rlbp1	A	T	7: 79,377,366	F182Y	probably benign	Het
Rnf148	G	C	6: 23,654,379	S206C	probably benign	Het
Sash1	A	G	10: 8,762,105	M1T	probably null	Het
Shank3	A	T	15: 89,549,395	T1448S	probably damaging	Het
Sipa1l1	A	G	12: 82,342,433	K478E	probably damaging	Het
Slitrk6	A	G	14: 110,751,369	I302T	probably benign	Het
Smc1b	A	G	15: 85,066,328	V1165A	probably damaging	Het
Sncaip	A	T	18: 52,915,309	H939L	probably benign	Het
Stn1	T	C	19: 47,536,270	D27G	probably damaging	Het
Sugct	T	G	13: 17,252,595		probably null	Het
Tmem259	A	G	10: 79,979,149	S214P	probably damaging	Het
Trdv4	G	A	14: 54,075,489	G107S	probably damaging	Het
Ttc3	C	T	16: 94,431,970	L957F	possibly damaging	Het
Ttn	A	G	2: 76,881,127	Y8357H	unknown	Het
Twnk	T	C	19: 45,007,995	V289A	probably benign	Het
Umodl1	A	G	17: 30,983,984	D437G	possibly damaging	Het
Upf1	T	C	8: 70,338,280	T590A	probably benign	Het
Vmn2r63	A	T	7: 42,927,017	D457E	probably benign	Het
Wdr82	A	T	9: 106,184,776	T213S	probably benign	Het
Zfp672	A	T	11: 58,329,764	M3K	unknown	Het
Zfyve26	A	G	12: 79,238,968	V2345A	probably benign	Het

Other mutations in Krt8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Krt8	APN	15	101998025	missense	probably benign
IGL01643:Krt8	APN	15	101997073	missense	possibly damaging	0.64
IGL01966:Krt8	APN	15	101997670	missense	probably benign	0.08
IGL02587:Krt8	APN	15	101998932	missense	probably benign	0.04
IGL03088:Krt8	APN	15	102000587	missense	possibly damaging	0.90
R0531:Krt8	UTSW	15	102001448	missense	probably benign	0.12
R1451:Krt8	UTSW	15	101998829	missense	possibly damaging	0.93
R2258:Krt8	UTSW	15	101998822	missense	probably benign
R2348:Krt8	UTSW	15	101998865	missense	probably benign	0.31
R2566:Krt8	UTSW	15	101998024	missense	probably benign	0.03
R3796:Krt8	UTSW	15	101999442	missense	probably benign	0.00
R4834:Krt8	UTSW	15	101998821	missense	probably damaging	1.00
R4965:Krt8	UTSW	15	101996951	missense	probably benign
R5212:Krt8	UTSW	15	101997967	missense	possibly damaging	0.52
R5249:Krt8	UTSW	15	101998440	missense	possibly damaging	0.69
R5419:Krt8	UTSW	15	102003902	missense	probably damaging	0.98
R5778:Krt8	UTSW	15	102003939	missense	probably damaging	0.99
R5997:Krt8	UTSW	15	102000594	missense	possibly damaging	0.77
R6503:Krt8	UTSW	15	101997934	missense	possibly damaging	0.66
R6683:Krt8	UTSW	15	101998004	missense	probably benign
R6812:Krt8	UTSW	15	101997979	missense	probably damaging	0.99
R6824:Krt8	UTSW	15	101998440	missense	possibly damaging	0.50
R6875:Krt8	UTSW	15	101997908	missense	probably benign	0.44
R7650:Krt8	UTSW	15	102004163	missense	probably benign	0.07
R8047:Krt8	UTSW	15	102003971	missense	probably damaging	0.99
R8559:Krt8	UTSW	15	102001544	missense	probably benign	0.03
R9146:Krt8	UTSW	15	101998935	missense	probably damaging	0.98
Z1177:Krt8	UTSW	15	101999435	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTGTCCTGGGCTAGACAGTC -3'
(R):5'- GATCCTGACTATAGCCTGATGTG -3'

Sequencing Primer
(F):5'- TCCTGAGACTGAAGCAAAACTG -3'
(R):5'- CTTCCTGGAGCAGCAGAAC -3'

Posted On

2021-07-15