Incidental Mutation 'R8826:Umodl1'
ID 673502
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission 068729-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8826 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 31173614-31229684 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31202958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 437 (D437G)
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect possibly damaging
Transcript: ENSMUST00000066554
AA Change: D437G

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: D437G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: D437G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: D437G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114555
AA Change: D437G

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: D437G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (91/91)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta1 T C 8: 124,619,978 (GRCm39) M121V probably damaging Het
AI987944 A T 7: 41,024,627 (GRCm39) H120Q possibly damaging Het
Aldh9a1 C G 1: 167,184,119 (GRCm39) P205A probably damaging Het
Ank2 A T 3: 126,740,951 (GRCm39) N1644K unknown Het
Arfgef2 A T 2: 166,677,386 (GRCm39) probably benign Het
Bpifb4 G T 2: 153,783,817 (GRCm39) V54L probably benign Het
Cacna1c T A 6: 118,711,836 (GRCm39) M456L Het
Cbln1 T C 8: 88,198,420 (GRCm39) N95S probably benign Het
Ccl11 G T 11: 81,953,044 (GRCm39) R67S possibly damaging Het
Cd200 G A 16: 45,215,157 (GRCm39) R165C probably benign Het
Cd2bp2 A T 7: 126,793,257 (GRCm39) M283K probably damaging Het
Cd86 G T 16: 36,435,650 (GRCm39) L256I possibly damaging Het
Ces2f T A 8: 105,679,734 (GRCm39) F409Y probably benign Het
Cisd3 A T 11: 97,579,158 (GRCm39) Q100L probably damaging Het
Cntnap1 C T 11: 101,077,655 (GRCm39) R1106C probably damaging Het
Col6a2 A T 10: 76,439,433 (GRCm39) M777K probably damaging Het
Cp A G 3: 20,039,739 (GRCm39) Y852C probably damaging Het
Ddx1 T C 12: 13,277,332 (GRCm39) E523G probably damaging Het
Ddx60 T A 8: 62,398,990 (GRCm39) D236E probably benign Het
Dnah9 A T 11: 65,740,742 (GRCm39) F4148Y probably benign Het
Dusp6 G T 10: 99,099,469 (GRCm39) probably benign Het
Eif2a C A 3: 58,456,049 (GRCm39) Y349* probably null Het
Enpep G A 3: 129,065,067 (GRCm39) T874I probably damaging Het
Eps15 A G 4: 109,169,505 (GRCm39) D105G possibly damaging Het
Ess2 A T 16: 17,722,954 (GRCm39) M320K probably damaging Het
Exosc10 G A 4: 148,653,159 (GRCm39) probably null Het
Fam13b A T 18: 34,631,070 (GRCm39) N36K probably damaging Het
Fanca T C 8: 123,995,209 (GRCm39) D1431G probably benign Het
Fgg A G 3: 82,921,625 (GRCm39) D436G probably benign Het
Fip1l1 C T 5: 74,725,188 (GRCm39) T251I probably benign Het
Galnt2 A G 8: 125,032,347 (GRCm39) N104S probably damaging Het
Gmip T C 8: 70,268,748 (GRCm39) S458P possibly damaging Het
Herc2 A G 7: 55,756,144 (GRCm39) D728G probably benign Het
Hif3a A G 7: 16,788,671 (GRCm39) L100P probably damaging Het
Hmox2 C G 16: 4,583,866 (GRCm39) P282R possibly damaging Het
Hook1 A T 4: 95,880,432 (GRCm39) H90L probably benign Het
Igf2bp2 C A 16: 21,883,866 (GRCm39) G473C probably damaging Het
Ip6k2 T C 9: 108,675,379 (GRCm39) probably null Het
Ipo5 G T 14: 121,157,366 (GRCm39) R68L probably damaging Het
Kif19b A G 5: 140,455,434 (GRCm39) M347V probably damaging Het
Klhdc1 G T 12: 69,305,392 (GRCm39) W234L probably damaging Het
Krt8 A G 15: 101,909,870 (GRCm39) V178A possibly damaging Het
Lgi3 T A 14: 70,768,712 (GRCm39) probably null Het
Litaf T G 16: 10,784,421 (GRCm39) N30H probably benign Het
Lman2 C A 13: 55,510,368 (GRCm39) W12L unknown Het
Macf1 A G 4: 123,276,022 (GRCm39) L6182P probably damaging Het
Magi3 A T 3: 103,992,662 (GRCm39) M270K probably benign Het
Mapre2 A T 18: 23,886,888 (GRCm39) probably benign Het
Minar1 T A 9: 89,483,234 (GRCm39) E721V probably damaging Het
Mllt10 T A 2: 18,167,353 (GRCm39) V426D probably benign Het
Mrgprf A G 7: 144,862,046 (GRCm39) I203V probably benign Het
Mrnip G A 11: 50,067,688 (GRCm39) C27Y probably damaging Het
Mrpl24 C T 3: 87,829,701 (GRCm39) R96* probably null Het
Nbas T A 12: 13,402,875 (GRCm39) probably benign Het
Nipal4 G A 11: 46,045,470 (GRCm39) T131M possibly damaging Het
Nlrp12 T C 7: 3,289,621 (GRCm39) D297G possibly damaging Het
Nol6 A C 4: 41,121,823 (GRCm39) M237R probably benign Het
Olig1 A G 16: 91,067,027 (GRCm39) E88G probably benign Het
Or1j19 T A 2: 36,676,855 (GRCm39) L106* probably null Het
Parg A G 14: 31,931,175 (GRCm39) D265G possibly damaging Het
Pcdhgb8 A T 18: 37,895,301 (GRCm39) I124L probably damaging Het
Pign A G 1: 105,481,827 (GRCm39) F822L probably damaging Het
Plch2 T C 4: 155,071,140 (GRCm39) T1080A probably benign Het
Pld4 A T 12: 112,733,210 (GRCm39) Y262F possibly damaging Het
Ppp1r12b A G 1: 134,693,730 (GRCm39) V977A probably benign Het
Ppp6r3 C T 19: 3,521,984 (GRCm39) E565K Het
Psmg2 A G 18: 67,787,158 (GRCm39) probably benign Het
Ptcd3 C T 6: 71,885,645 (GRCm39) G27D probably benign Het
Retreg2 G T 1: 75,119,525 (GRCm39) G7C unknown Het
Rlbp1 A T 7: 79,027,114 (GRCm39) F182Y probably benign Het
Rnf148 G C 6: 23,654,378 (GRCm39) S206C probably benign Het
Sash1 A G 10: 8,637,869 (GRCm39) M1T probably null Het
Shank3 A T 15: 89,433,598 (GRCm39) T1448S probably damaging Het
Sipa1l1 A G 12: 82,389,207 (GRCm39) K478E probably damaging Het
Slitrk6 A G 14: 110,988,801 (GRCm39) I302T probably benign Het
Smc1b A G 15: 84,950,529 (GRCm39) V1165A probably damaging Het
Sncaip A T 18: 53,048,381 (GRCm39) H939L probably benign Het
Stn1 T C 19: 47,524,709 (GRCm39) D27G probably damaging Het
Sugct T G 13: 17,427,180 (GRCm39) probably null Het
Tmem259 A G 10: 79,814,983 (GRCm39) S214P probably damaging Het
Trdv4 G A 14: 54,312,946 (GRCm39) G107S probably damaging Het
Ttc3 C T 16: 94,232,829 (GRCm39) L957F possibly damaging Het
Ttn A G 2: 76,711,471 (GRCm39) Y8357H unknown Het
Twnk T C 19: 44,996,434 (GRCm39) V289A probably benign Het
Upf1 T C 8: 70,790,930 (GRCm39) T590A probably benign Het
Vmn2r63 A T 7: 42,576,441 (GRCm39) D457E probably benign Het
Wdr82 A T 9: 106,061,975 (GRCm39) T213S probably benign Het
Zfp267 T C 3: 36,218,255 (GRCm39) Y93H possibly damaging Het
Zfp672 A T 11: 58,220,590 (GRCm39) M3K unknown Het
Zfyve26 A G 12: 79,285,742 (GRCm39) V2345A probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31,227,724 (GRCm39) utr 3 prime probably benign
IGL01344:Umodl1 APN 17 31,215,238 (GRCm39) missense probably damaging 0.99
IGL01529:Umodl1 APN 17 31,215,233 (GRCm39) missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 31,217,800 (GRCm39) missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 31,215,229 (GRCm39) missense probably benign 0.00
IGL01877:Umodl1 APN 17 31,201,294 (GRCm39) missense probably benign 0.00
IGL01977:Umodl1 APN 17 31,192,742 (GRCm39) missense probably damaging 0.99
IGL02063:Umodl1 APN 17 31,206,888 (GRCm39) missense probably benign 0.07
IGL02160:Umodl1 APN 17 31,205,091 (GRCm39) missense probably damaging 0.97
IGL02252:Umodl1 APN 17 31,213,789 (GRCm39) critical splice donor site probably null
IGL02427:Umodl1 APN 17 31,187,415 (GRCm39) splice site probably benign
IGL02496:Umodl1 APN 17 31,217,628 (GRCm39) missense probably damaging 0.99
IGL02633:Umodl1 APN 17 31,208,462 (GRCm39) missense probably damaging 1.00
IGL03271:Umodl1 APN 17 31,205,473 (GRCm39) nonsense probably null
IGL03392:Umodl1 APN 17 31,215,329 (GRCm39) missense probably damaging 0.98
Disquieting UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
floored UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7231_umodl1_507 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
surprising UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
unsettling UTSW 17 31,205,528 (GRCm39) nonsense probably null
G1citation:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
PIT4468001:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0653:Umodl1 UTSW 17 31,203,002 (GRCm39) missense probably benign 0.00
R0831:Umodl1 UTSW 17 31,215,325 (GRCm39) missense probably damaging 1.00
R1078:Umodl1 UTSW 17 31,178,347 (GRCm39) missense probably benign 0.00
R1166:Umodl1 UTSW 17 31,221,772 (GRCm39) splice site probably benign
R1231:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R1459:Umodl1 UTSW 17 31,205,478 (GRCm39) missense probably benign 0.05
R1459:Umodl1 UTSW 17 31,201,232 (GRCm39) splice site probably benign
R1510:Umodl1 UTSW 17 31,178,203 (GRCm39) missense probably damaging 1.00
R1654:Umodl1 UTSW 17 31,206,942 (GRCm39) missense probably benign
R1757:Umodl1 UTSW 17 31,227,674 (GRCm39) missense probably damaging 0.99
R1781:Umodl1 UTSW 17 31,187,524 (GRCm39) missense probably damaging 1.00
R1873:Umodl1 UTSW 17 31,201,238 (GRCm39) missense probably damaging 0.99
R1911:Umodl1 UTSW 17 31,211,128 (GRCm39) missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R1918:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2058:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2089:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2431:Umodl1 UTSW 17 31,211,062 (GRCm39) missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 31,211,147 (GRCm39) missense probably damaging 1.00
R3032:Umodl1 UTSW 17 31,208,502 (GRCm39) missense probably benign 0.01
R3956:Umodl1 UTSW 17 31,221,837 (GRCm39) missense probably benign 0.10
R3975:Umodl1 UTSW 17 31,203,763 (GRCm39) nonsense probably null
R4207:Umodl1 UTSW 17 31,178,341 (GRCm39) missense probably damaging 1.00
R4287:Umodl1 UTSW 17 31,207,039 (GRCm39) missense probably benign 0.11
R4452:Umodl1 UTSW 17 31,213,789 (GRCm39) critical splice donor site probably null
R4684:Umodl1 UTSW 17 31,217,088 (GRCm39) missense probably benign 0.00
R4769:Umodl1 UTSW 17 31,202,976 (GRCm39) missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R4888:Umodl1 UTSW 17 31,218,175 (GRCm39) missense probably damaging 1.00
R4978:Umodl1 UTSW 17 31,205,055 (GRCm39) missense probably benign
R4993:Umodl1 UTSW 17 31,205,459 (GRCm39) missense probably benign 0.00
R5241:Umodl1 UTSW 17 31,203,066 (GRCm39) missense probably benign 0.18
R5254:Umodl1 UTSW 17 31,199,333 (GRCm39) missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 31,201,263 (GRCm39) missense probably benign 0.04
R5754:Umodl1 UTSW 17 31,213,761 (GRCm39) missense probably damaging 0.96
R6189:Umodl1 UTSW 17 31,215,256 (GRCm39) missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31,221,866 (GRCm39) critical splice donor site probably null
R6289:Umodl1 UTSW 17 31,201,325 (GRCm39) missense probably benign 0.16
R6432:Umodl1 UTSW 17 31,205,121 (GRCm39) missense probably benign 0.38
R6478:Umodl1 UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
R6702:Umodl1 UTSW 17 31,205,273 (GRCm39) splice site probably null
R6822:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
R6999:Umodl1 UTSW 17 31,218,097 (GRCm39) missense probably damaging 1.00
R7067:Umodl1 UTSW 17 31,201,246 (GRCm39) missense probably damaging 1.00
R7123:Umodl1 UTSW 17 31,201,318 (GRCm39) missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 31,201,236 (GRCm39) critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
R7234:Umodl1 UTSW 17 31,205,595 (GRCm39) missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R7392:Umodl1 UTSW 17 31,201,306 (GRCm39) missense probably damaging 0.99
R7401:Umodl1 UTSW 17 31,217,122 (GRCm39) missense probably damaging 1.00
R7461:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7594:Umodl1 UTSW 17 31,173,779 (GRCm39) missense probably benign 0.02
R7613:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7763:Umodl1 UTSW 17 31,205,430 (GRCm39) missense probably benign 0.24
R7797:Umodl1 UTSW 17 31,178,125 (GRCm39) missense probably benign 0.02
R7832:Umodl1 UTSW 17 31,192,666 (GRCm39) critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 31,205,361 (GRCm39) missense probably benign 0.00
R8088:Umodl1 UTSW 17 31,192,770 (GRCm39) missense probably benign 0.29
R8111:Umodl1 UTSW 17 31,190,792 (GRCm39) missense probably damaging 0.99
R8314:Umodl1 UTSW 17 31,203,806 (GRCm39) missense probably damaging 0.99
R9067:Umodl1 UTSW 17 31,192,677 (GRCm39) missense probably damaging 1.00
R9091:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9099:Umodl1 UTSW 17 31,178,147 (GRCm39) missense probably benign 0.01
R9270:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9341:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 31,215,367 (GRCm39) missense probably damaging 0.99
R9569:Umodl1 UTSW 17 31,217,143 (GRCm39) missense probably damaging 1.00
R9615:Umodl1 UTSW 17 31,217,152 (GRCm39) missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 31,178,324 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCCCTTCAAGGACAGTTGG -3'
(R):5'- TGCACGAATGTCCTCTGCTG -3'

Sequencing Primer
(F):5'- TGGACTGTCCATGAGTAGCCAG -3'
(R):5'- TCTGCTGGTCAACCTGGAACAC -3'
Posted On 2021-07-15