Incidental Mutation 'R8827:Adamts3'
ID 673523
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms 6330442E02Rik, 1100001H14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8827 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89677087-89883334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89691465 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 810 (I810V)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: I809V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: I809V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: I810V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: I810V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,312 N250K probably benign Het
4932415D10Rik T A 10: 82,293,783 Q1131L probably benign Het
Adcy7 T C 8: 88,309,699 F128S possibly damaging Het
Ankhd1 C T 18: 36,624,580 Q188* probably null Het
Asxl2 A T 12: 3,500,501 I748L probably benign Het
Atp8b2 T C 3: 89,946,000 N70S Het
Bmp1 A G 14: 70,490,642 Y616H probably damaging Het
Brap T A 5: 121,672,198 D248E probably benign Het
Ccdc13 G A 9: 121,816,699 S294L probably benign Het
Ccdc130 T A 8: 84,260,358 Q170L possibly damaging Het
Cdkl1 T C 12: 69,747,349 Y338C probably benign Het
Cfap54 A T 10: 92,938,248 S1993T unknown Het
Chl1 G T 6: 103,693,150 M500I probably benign Het
Cntn3 G C 6: 102,269,133 L352V probably benign Het
Cog6 T C 3: 52,983,114 D635G probably benign Het
Col22a1 C A 15: 71,902,816 probably null Het
Cyp3a16 A T 5: 145,450,198 D327E probably benign Het
D6Ertd527e A T 6: 87,111,244 S130C unknown Het
Dhodh T C 8: 109,608,296 probably benign Het
Dirc2 A T 16: 35,733,950 C274S probably benign Het
Dync2li1 C T 17: 84,647,651 S246L possibly damaging Het
Eif3c A T 7: 126,558,722 F316Y probably damaging Het
Esp34 A T 17: 38,554,200 probably benign Het
Fam98a T C 17: 75,544,829 M86V possibly damaging Het
Gm29394 G T 15: 58,069,321 Q7K probably damaging Het
Gtf2i C T 5: 134,240,242 probably null Het
Hecw1 A G 13: 14,264,135 Y888H probably damaging Het
Hist3h2ba C T 11: 58,949,091 P51L probably benign Het
Kcnma1 A T 14: 23,367,480 W894R probably damaging Het
Klhl25 C A 7: 75,866,643 D432E possibly damaging Het
Klhl7 G A 5: 24,158,637 probably null Het
Lamc1 A T 1: 153,221,678 L1540Q probably damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Map4k5 C T 12: 69,856,861 D57N possibly damaging Het
Mpped2 T C 2: 106,861,583 M211T possibly damaging Het
Nat9 T C 11: 115,184,513 T101A probably benign Het
Nprl3 A T 11: 32,234,742 F447L probably benign Het
Olfr1140 C T 2: 87,746,433 P79L possibly damaging Het
Olfr1184 T C 2: 88,486,821 S30P probably damaging Het
Olfr192 G A 16: 59,098,698 T98I unknown Het
Orc3 A T 4: 34,605,569 F104Y probably benign Het
Pcdha6 T A 18: 36,969,749 V665E probably damaging Het
Pdpk1 T C 17: 24,088,217 D380G probably benign Het
Phkg1 T A 5: 129,865,053 E280D probably benign Het
Pkdrej T A 15: 85,815,531 Y2068F possibly damaging Het
Plekhg5 A G 4: 152,107,005 probably benign Het
Plekhh3 G A 11: 101,167,554 P222L probably damaging Het
Prdm1 A T 10: 44,458,480 V10E probably benign Het
Prdm6 G T 18: 53,568,195 Q513H probably damaging Het
Pros1 T C 16: 62,926,464 V593A probably benign Het
Radil T C 5: 142,508,104 H250R probably damaging Het
Rasa2 C T 9: 96,552,350 R628Q probably damaging Het
Ryr2 T C 13: 11,558,048 E4884G possibly damaging Het
Shh A G 5: 28,458,127 S348P probably damaging Het
Slc1a4 A T 11: 20,320,237 probably benign Het
Slc32a1 A C 2: 158,611,354 D38A probably damaging Het
Slc35f3 TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,041 probably benign Het
Slc45a4 A T 15: 73,586,467 I411N probably benign Het
Slc7a10 C A 7: 35,197,888 S248Y probably damaging Het
Smc3 T A 19: 53,622,654 D258E probably benign Het
Sphk1 A G 11: 116,535,764 D182G probably damaging Het
Srgap3 A G 6: 112,739,341 Y633H probably damaging Het
Sspo T G 6: 48,457,672 F1033V possibly damaging Het
Syne2 T C 12: 76,048,583 V488A probably benign Het
Tead1 A C 7: 112,876,242 K299N probably damaging Het
Tmem150c A C 5: 100,092,795 S69R probably damaging Het
Tnfaip3 T A 10: 19,005,047 K424M probably damaging Het
Trib3 A G 2: 152,338,268 V335A possibly damaging Het
Ttc39c G A 18: 12,695,379 V199I probably benign Het
Vangl1 A T 3: 102,163,420 F400Y probably damaging Het
Vmn2r106 A T 17: 20,267,606 S844T probably benign Het
Wwtr1 A G 3: 57,575,195 V77A probably damaging Het
Zc3h4 C A 7: 16,429,198 P500T unknown Het
Zfand2a C T 5: 139,474,852 probably null Het
Zfr2 A G 10: 81,242,785 T284A probably benign Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7401:Adamts3 UTSW 5 89707450 critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 89861397 missense probably benign 0.00
R7829:Adamts3 UTSW 5 89861490 missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R8021:Adamts3 UTSW 5 89683184 missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89775423 missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89702956 missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89694768 missense probably benign 0.19
R8864:Adamts3 UTSW 5 89707122 intron probably benign
R8906:Adamts3 UTSW 5 89677716 missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89706711 missense probably benign 0.17
R9005:Adamts3 UTSW 5 89677834 missense probably benign 0.08
R9378:Adamts3 UTSW 5 89700410 nonsense probably null
R9505:Adamts3 UTSW 5 89707892 missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89686891 missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89775351 missense not run
Z1177:Adamts3 UTSW 5 89707864 nonsense probably null
Z1177:Adamts3 UTSW 5 89775351 missense not run
Predicted Primers PCR Primer
(F):5'- AATGCAGCTGTTACCTCCG -3'
(R):5'- AAGGTTTTGTTTCGGCTACAACTG -3'

Sequencing Primer
(F):5'- AGCTGTTACCTCCGCCACAG -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On 2021-07-15