Incidental Mutation 'R8827:D6Ertd527e'
ID 673532
Institutional Source Beutler Lab
Gene Symbol D6Ertd527e
Ensembl Gene ENSMUSG00000090891
Gene Name DNA segment, Chr 6, ERATO Doi 527, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock # R8827 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 87104746-87112997 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87111244 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 130 (S130C)
Ref Sequence ENSEMBL: ENSMUSP00000145529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170124] [ENSMUST00000203747] [ENSMUST00000204927]
AlphaFold A0A0N4SWI3
Predicted Effect unknown
Transcript: ENSMUST00000170124
AA Change: S129C
SMART Domains Protein: ENSMUSP00000130803
Gene: ENSMUSG00000090891
AA Change: S129C

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203747
AA Change: S129C
SMART Domains Protein: ENSMUSP00000144761
Gene: ENSMUSG00000090891
AA Change: S129C

DomainStartEndE-ValueType
low complexity region 5 182 N/A INTRINSIC
internal_repeat_1 185 206 1.04e-33 PROSPERO
low complexity region 211 242 N/A INTRINSIC
internal_repeat_2 243 253 2.12e-11 PROSPERO
internal_repeat_2 259 269 2.12e-11 PROSPERO
low complexity region 271 293 N/A INTRINSIC
internal_repeat_1 296 317 1.04e-33 PROSPERO
low complexity region 322 458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204927
AA Change: S130C
SMART Domains Protein: ENSMUSP00000145529
Gene: ENSMUSG00000090891
AA Change: S130C

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,312 N250K probably benign Het
4932415D10Rik T A 10: 82,293,783 Q1131L probably benign Het
Adamts3 T C 5: 89,691,465 I810V probably benign Het
Adcy7 T C 8: 88,309,699 F128S possibly damaging Het
Ankhd1 C T 18: 36,624,580 Q188* probably null Het
Asxl2 A T 12: 3,500,501 I748L probably benign Het
Atp8b2 T C 3: 89,946,000 N70S Het
Bmp1 A G 14: 70,490,642 Y616H probably damaging Het
Brap T A 5: 121,672,198 D248E probably benign Het
Ccdc13 G A 9: 121,816,699 S294L probably benign Het
Ccdc130 T A 8: 84,260,358 Q170L possibly damaging Het
Cdkl1 T C 12: 69,747,349 Y338C probably benign Het
Cfap54 A T 10: 92,938,248 S1993T unknown Het
Chl1 G T 6: 103,693,150 M500I probably benign Het
Cntn3 G C 6: 102,269,133 L352V probably benign Het
Cog6 T C 3: 52,983,114 D635G probably benign Het
Col22a1 C A 15: 71,902,816 probably null Het
Cyp3a16 A T 5: 145,450,198 D327E probably benign Het
Dhodh T C 8: 109,608,296 probably benign Het
Dirc2 A T 16: 35,733,950 C274S probably benign Het
Dync2li1 C T 17: 84,647,651 S246L possibly damaging Het
Eif3c A T 7: 126,558,722 F316Y probably damaging Het
Esp34 A T 17: 38,554,200 probably benign Het
Fam98a T C 17: 75,544,829 M86V possibly damaging Het
Gm29394 G T 15: 58,069,321 Q7K probably damaging Het
Gtf2i C T 5: 134,240,242 probably null Het
Hecw1 A G 13: 14,264,135 Y888H probably damaging Het
Hist3h2ba C T 11: 58,949,091 P51L probably benign Het
Kcnma1 A T 14: 23,367,480 W894R probably damaging Het
Klhl25 C A 7: 75,866,643 D432E possibly damaging Het
Klhl7 G A 5: 24,158,637 probably null Het
Lamc1 A T 1: 153,221,678 L1540Q probably damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Map4k5 C T 12: 69,856,861 D57N possibly damaging Het
Mpped2 T C 2: 106,861,583 M211T possibly damaging Het
Nat9 T C 11: 115,184,513 T101A probably benign Het
Nprl3 A T 11: 32,234,742 F447L probably benign Het
Olfr1140 C T 2: 87,746,433 P79L possibly damaging Het
Olfr1184 T C 2: 88,486,821 S30P probably damaging Het
Olfr192 G A 16: 59,098,698 T98I unknown Het
Orc3 A T 4: 34,605,569 F104Y probably benign Het
Pcdha6 T A 18: 36,969,749 V665E probably damaging Het
Pdpk1 T C 17: 24,088,217 D380G probably benign Het
Phkg1 T A 5: 129,865,053 E280D probably benign Het
Pkdrej T A 15: 85,815,531 Y2068F possibly damaging Het
Plekhg5 A G 4: 152,107,005 probably benign Het
Plekhh3 G A 11: 101,167,554 P222L probably damaging Het
Prdm1 A T 10: 44,458,480 V10E probably benign Het
Prdm6 G T 18: 53,568,195 Q513H probably damaging Het
Pros1 T C 16: 62,926,464 V593A probably benign Het
Radil T C 5: 142,508,104 H250R probably damaging Het
Rasa2 C T 9: 96,552,350 R628Q probably damaging Het
Ryr2 T C 13: 11,558,048 E4884G possibly damaging Het
Shh A G 5: 28,458,127 S348P probably damaging Het
Slc1a4 A T 11: 20,320,237 probably benign Het
Slc32a1 A C 2: 158,611,354 D38A probably damaging Het
Slc35f3 TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,041 probably benign Het
Slc45a4 A T 15: 73,586,467 I411N probably benign Het
Slc7a10 C A 7: 35,197,888 S248Y probably damaging Het
Smc3 T A 19: 53,622,654 D258E probably benign Het
Sphk1 A G 11: 116,535,764 D182G probably damaging Het
Srgap3 A G 6: 112,739,341 Y633H probably damaging Het
Sspo T G 6: 48,457,672 F1033V possibly damaging Het
Syne2 T C 12: 76,048,583 V488A probably benign Het
Tead1 A C 7: 112,876,242 K299N probably damaging Het
Tmem150c A C 5: 100,092,795 S69R probably damaging Het
Tnfaip3 T A 10: 19,005,047 K424M probably damaging Het
Trib3 A G 2: 152,338,268 V335A possibly damaging Het
Ttc39c G A 18: 12,695,379 V199I probably benign Het
Vangl1 A T 3: 102,163,420 F400Y probably damaging Het
Vmn2r106 A T 17: 20,267,606 S844T probably benign Het
Wwtr1 A G 3: 57,575,195 V77A probably damaging Het
Zc3h4 C A 7: 16,429,198 P500T unknown Het
Zfand2a C T 5: 139,474,852 probably null Het
Zfr2 A G 10: 81,242,785 T284A probably benign Het
Other mutations in D6Ertd527e
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bursting UTSW 6 87111317 missense unknown
R0739_D6Ertd527e_618 UTSW 6 87111668 missense unknown
sonenschein UTSW 6 87111524 missense unknown
R0325:D6Ertd527e UTSW 6 87111295 missense unknown
R0415:D6Ertd527e UTSW 6 87111524 missense unknown
R0607:D6Ertd527e UTSW 6 87111905 missense unknown
R0739:D6Ertd527e UTSW 6 87111668 missense unknown
R0992:D6Ertd527e UTSW 6 87111524 missense unknown
R0993:D6Ertd527e UTSW 6 87111524 missense unknown
R1193:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1196:D6Ertd527e UTSW 6 87111524 missense unknown
R1386:D6Ertd527e UTSW 6 87111524 missense unknown
R1413:D6Ertd527e UTSW 6 87111353 missense unknown
R1485:D6Ertd527e UTSW 6 87111085 missense unknown
R1560:D6Ertd527e UTSW 6 87111524 missense unknown
R1561:D6Ertd527e UTSW 6 87111524 missense unknown
R1568:D6Ertd527e UTSW 6 87111524 missense unknown
R2290:D6Ertd527e UTSW 6 87111545 missense unknown
R4155:D6Ertd527e UTSW 6 87111524 missense unknown
R4461:D6Ertd527e UTSW 6 87111317 missense unknown
R4836:D6Ertd527e UTSW 6 87111424 small insertion probably benign
R5102:D6Ertd527e UTSW 6 87111811 missense unknown
R5149:D6Ertd527e UTSW 6 87111524 missense unknown
R5150:D6Ertd527e UTSW 6 87111524 missense unknown
R5681:D6Ertd527e UTSW 6 87111206 missense unknown
R6250:D6Ertd527e UTSW 6 87111212 missense unknown
R6398:D6Ertd527e UTSW 6 87111524 missense unknown
R6441:D6Ertd527e UTSW 6 87111524 missense unknown
R7001:D6Ertd527e UTSW 6 87111212 missense unknown
R7142:D6Ertd527e UTSW 6 87111524 missense unknown
R7297:D6Ertd527e UTSW 6 87111524 missense unknown
R7821:D6Ertd527e UTSW 6 87110897 missense unknown
R8047:D6Ertd527e UTSW 6 87111472 missense unknown
R9038:D6Ertd527e UTSW 6 87112251 makesense probably null
S24628:D6Ertd527e UTSW 6 87111524 missense unknown
V1662:D6Ertd527e UTSW 6 87111892 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTTGATCCAGAAGACATGTG -3'
(R):5'- CTGCTGCCTGTGTTACTAGG -3'

Sequencing Primer
(F):5'- CCAGAAGACATGTGTGTGCTGC -3'
(R):5'- GCTGCCTGTGTTACTAGGTCTTC -3'
Posted On 2021-07-15