Incidental Mutation 'R8827:Nprl3'
ID 673553
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 068658-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R8827 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32184742 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 447 (F447L)
Ref Sequence ENSEMBL: ENSMUSP00000020530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020528] [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000138050] [ENSMUST00000141859] [ENSMUST00000142964]
AlphaFold Q8VIJ8
Predicted Effect probably benign
Transcript: ENSMUST00000020528
SMART Domains Protein: ENSMUSP00000020528
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:Pur_DNA_glyco 109 304 1.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020530
AA Change: F447L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: F447L

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109389
AA Change: F422L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: F422L

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138050
SMART Domains Protein: ENSMUSP00000121960
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142964
SMART Domains Protein: ENSMUSP00000118208
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,839,324 (GRCm39) I810V probably benign Het
Adcy7 T C 8: 89,036,327 (GRCm39) F128S possibly damaging Het
Ankhd1 C T 18: 36,757,633 (GRCm39) Q188* probably null Het
Asxl2 A T 12: 3,550,501 (GRCm39) I748L probably benign Het
Atp8b2 T C 3: 89,853,307 (GRCm39) N70S Het
Bmp1 A G 14: 70,728,082 (GRCm39) Y616H probably damaging Het
Brap T A 5: 121,810,261 (GRCm39) D248E probably benign Het
Ccdc13 G A 9: 121,645,765 (GRCm39) S294L probably benign Het
Cdkl1 T C 12: 69,794,123 (GRCm39) Y338C probably benign Het
Cfap54 A T 10: 92,774,110 (GRCm39) S1993T unknown Het
Chl1 G T 6: 103,670,111 (GRCm39) M500I probably benign Het
Cntn3 G C 6: 102,246,094 (GRCm39) L352V probably benign Het
Cog6 T C 3: 52,890,535 (GRCm39) D635G probably benign Het
Col22a1 C A 15: 71,774,665 (GRCm39) probably null Het
Cyp3a16 A T 5: 145,387,008 (GRCm39) D327E probably benign Het
D6Ertd527e A T 6: 87,088,226 (GRCm39) S130C unknown Het
Dhodh T C 8: 110,334,928 (GRCm39) probably benign Het
Dync2li1 C T 17: 84,955,079 (GRCm39) S246L possibly damaging Het
Eif3c A T 7: 126,157,894 (GRCm39) F316Y probably damaging Het
Esp34 A T 17: 38,865,091 (GRCm39) probably benign Het
Fam98a T C 17: 75,851,824 (GRCm39) M86V possibly damaging Het
Gm29394 G T 15: 57,932,717 (GRCm39) Q7K probably damaging Het
Gtf2i C T 5: 134,269,096 (GRCm39) probably null Het
H2bc27 C T 11: 58,839,917 (GRCm39) P51L probably benign Het
Hecw1 A G 13: 14,438,720 (GRCm39) Y888H probably damaging Het
Kcnma1 A T 14: 23,417,548 (GRCm39) W894R probably damaging Het
Klhl25 C A 7: 75,516,391 (GRCm39) D432E possibly damaging Het
Klhl7 G A 5: 24,363,635 (GRCm39) probably null Het
Lamc1 A T 1: 153,097,424 (GRCm39) L1540Q probably damaging Het
Map3k5 T A 10: 19,902,003 (GRCm39) V358E probably damaging Het
Map4k5 C T 12: 69,903,635 (GRCm39) D57N possibly damaging Het
Mpped2 T C 2: 106,691,928 (GRCm39) M211T possibly damaging Het
Nat9 T C 11: 115,075,339 (GRCm39) T101A probably benign Het
Nup50l G T 6: 96,142,293 (GRCm39) N250K probably benign Het
Or4p22 T C 2: 88,317,165 (GRCm39) S30P probably damaging Het
Or5h24 G A 16: 58,919,061 (GRCm39) T98I unknown Het
Or5w16 C T 2: 87,576,777 (GRCm39) P79L possibly damaging Het
Orc3 A T 4: 34,605,569 (GRCm39) F104Y probably benign Het
Pcdha6 T A 18: 37,102,802 (GRCm39) V665E probably damaging Het
Pdpk1 T C 17: 24,307,191 (GRCm39) D380G probably benign Het
Phkg1 T A 5: 129,893,894 (GRCm39) E280D probably benign Het
Pkdrej T A 15: 85,699,732 (GRCm39) Y2068F possibly damaging Het
Plekhg5 A G 4: 152,191,462 (GRCm39) probably benign Het
Plekhh3 G A 11: 101,058,380 (GRCm39) P222L probably damaging Het
Prdm1 A T 10: 44,334,476 (GRCm39) V10E probably benign Het
Prdm6 G T 18: 53,701,267 (GRCm39) Q513H probably damaging Het
Pros1 T C 16: 62,746,827 (GRCm39) V593A probably benign Het
Radil T C 5: 142,493,859 (GRCm39) H250R probably damaging Het
Rasa2 C T 9: 96,434,403 (GRCm39) R628Q probably damaging Het
Ryr2 T C 13: 11,572,934 (GRCm39) E4884G possibly damaging Het
Shh A G 5: 28,663,125 (GRCm39) S348P probably damaging Het
Slc1a4 A T 11: 20,270,237 (GRCm39) probably benign Het
Slc32a1 A C 2: 158,453,274 (GRCm39) D38A probably damaging Het
Slc35f3 TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,780 (GRCm39) probably benign Het
Slc45a4 A T 15: 73,458,316 (GRCm39) I411N probably benign Het
Slc49a4 A T 16: 35,554,320 (GRCm39) C274S probably benign Het
Slc7a10 C A 7: 34,897,313 (GRCm39) S248Y probably damaging Het
Smc3 T A 19: 53,611,085 (GRCm39) D258E probably benign Het
Spata31h1 T A 10: 82,129,617 (GRCm39) Q1131L probably benign Het
Sphk1 A G 11: 116,426,590 (GRCm39) D182G probably damaging Het
Srgap3 A G 6: 112,716,302 (GRCm39) Y633H probably damaging Het
Sspo T G 6: 48,434,606 (GRCm39) F1033V possibly damaging Het
Syne2 T C 12: 76,095,357 (GRCm39) V488A probably benign Het
Tead1 A C 7: 112,475,449 (GRCm39) K299N probably damaging Het
Tmem150c A C 5: 100,240,654 (GRCm39) S69R probably damaging Het
Tnfaip3 T A 10: 18,880,795 (GRCm39) K424M probably damaging Het
Trib3 A G 2: 152,180,188 (GRCm39) V335A possibly damaging Het
Ttc39c G A 18: 12,828,436 (GRCm39) V199I probably benign Het
Vangl1 A T 3: 102,070,736 (GRCm39) F400Y probably damaging Het
Vmn2r106 A T 17: 20,487,868 (GRCm39) S844T probably benign Het
Wwtr1 A G 3: 57,482,616 (GRCm39) V77A probably damaging Het
Yju2b T A 8: 84,986,987 (GRCm39) Q170L possibly damaging Het
Zc3h4 C A 7: 16,163,123 (GRCm39) P500T unknown Het
Zfand2a C T 5: 139,460,607 (GRCm39) probably null Het
Zfr2 A G 10: 81,078,619 (GRCm39) T284A probably benign Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGATGCTCCTGACTACAGCTAG -3'
(R):5'- AGACCCAGCTCATCCAGATG -3'

Sequencing Primer
(F):5'- GCTAGCTGCTCAGGGAAG -3'
(R):5'- ATCCAGATGGTGGTGTGGATGC -3'
Posted On 2021-07-15