Mutagenetix > Incidental Mutations

Incidental Mutation 'T0722:Klhl14'

67356

Institutional Source

Beutler Lab

Gene Symbol

Klhl14

Ensembl Gene

ENSMUSG00000042514

Gene Name

kelch-like 14

Synonyms

printor, 6330403N15Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

T0722 (G3) of strain 711

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21550377-21654718 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21558135 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 446 (Y446C)

Ref Sequence

ENSEMBL: ENSMUSP00000113755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049105] [ENSMUST00000122333]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049105
AA Change: Y446C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042015
Gene: ENSMUSG00000042514
AA Change: Y446C

Domain	Start	End	E-Value	Type
BTB	33	183	6.57e-25	SMART
BACK	191	281	2.61e-9	SMART
Kelch	325	374	1.63e-1	SMART
Kelch	375	426	3.66e-2	SMART
Kelch	427	473	5.05e-14	SMART
Kelch	474	520	1.79e-5	SMART
Kelch	521	572	3.06e-4	SMART
Kelch	573	622	5.29e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000122333
AA Change: Y446C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113755
Gene: ENSMUSG00000042514
AA Change: Y446C

Domain	Start	End	E-Value	Type
BTB	33	183	6.57e-25	SMART
BACK	191	281	2.61e-9	SMART
Kelch	325	374	1.63e-1	SMART
Kelch	375	426	3.66e-2	SMART
Kelch	427	473	5.05e-14	SMART
Kelch	474	520	1.79e-5	SMART
Kelch	521	572	3.06e-4	SMART
Kelch	573	622	5.29e-1	SMART

Meta Mutation Damage Score

0.9685

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kelch-like gene family, whose members contain a BTB/POZ domain, a BACK domain, and several Kelch domains. The encoded protein possesses six Kelch domains and localizes to the endoplasmic reticulum, where it interacts with torsin-1A. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	G	12: 113,489,577	T5A	possibly damaging	Het
Adam6b	T	A	12: 113,491,268	D568E	probably benign	Het
Ago3	C	T	4: 126,404,263	V155I	probably benign	Het
Ago3	T	G	4: 126,404,296	T144P	probably benign	Het
Ago3	C	T	4: 126,404,305	A141T	probably benign	Het
Ago3	G	A	4: 126,404,310	A139V	probably benign	Het
Ahdc1	ACCTCCT	ACCTCCTCCT	4: 133,062,754		probably benign	Het
Atp6v1g3	T	A	1: 138,273,853		probably benign	Het
Azin2	A	G	4: 128,946,134	Y222H	probably benign	Het
Bicd2	C	A	13: 49,379,651	P571Q	probably benign	Het
Camta2	A	G	11: 70,684,005	I75T	probably damaging	Het
Casp1	A	T	9: 5,299,851	H108L	probably benign	Het
Cdk5r1	G	T	11: 80,477,881	V125F	probably benign	Het
Cherp	TTGGACCTGGACCTGGACCTGGACCTGGA	TTGGACCTGGACCTGGACCTGGA	8: 72,462,034		probably benign	Het
Cngb1	A	G	8: 95,296,650	M240T	probably benign	Het
Cngb1	G	T	8: 95,297,819	Q205K	probably damaging	Het
Cngb1	T	C	8: 95,303,696		probably benign	Het
Cngb1	G	A	8: 95,303,714		probably benign	Het
Cog8	G	T	8: 107,048,993	L580I	probably benign	Het
Copa	A	G	1: 172,111,948	E593G	possibly damaging	Het
Ctrc	T	TA	4: 141,845,196		probably null	Het
Cwf19l2	T	C	9: 3,456,755	F696S	probably benign	Het
Ddi2	G	A	4: 141,713,473		probably benign	Het
Eml5	T	C	12: 98,841,582	D984G	probably null	Het
Fam135b	T	G	15: 71,463,885	T487P	probably damaging	Het
Fstl3	A	G	10: 79,780,163	Y161C	probably damaging	Het
Gja4	G	C	4: 127,312,231	H246Q	probably benign	Het
Gm8186	C	T	17: 26,099,127	R32Q	probably benign	Het
Gm8394	A	G	10: 85,313,593		noncoding transcript	Het
Jakmip1	C	A	5: 37,118,903	A519D	probably damaging	Het
Jcad	G	T	18: 4,675,531	A1098S	probably benign	Het
Lims1	A	G	10: 58,418,455	N344D	probably benign	Het
Marco	A	T	1: 120,474,712	W502R	probably damaging	Het
Mmp13	G	T	9: 7,280,857	M413I	possibly damaging	Het
Mmp25	G	A	17: 23,631,218	A456V	possibly damaging	Het
Msi2	A	T	11: 88,394,597	M207K	probably damaging	Het
Myh8	G	A	11: 67,304,436	R1692Q	probably benign	Het
Nbas	A	G	12: 13,352,808	I788V	probably benign	Het
Nup188	A	G	2: 30,322,681	D632G	probably damaging	Het
Olfr1141	T	A	2: 87,753,123	Y290F	probably damaging	Het
Olfr1219	A	G	2: 89,074,959	V44A	probably benign	Het
Olfr354	T	C	2: 36,907,570	V208A	probably benign	Het
Olfr360	T	G	2: 37,068,437	L44R	probably damaging	Het
Opa1	T	C	16: 29,610,930		probably null	Het
Pabpc1l	G	A	2: 164,042,420	G359D	possibly damaging	Het
Papd7	G	A	13: 69,506,955	R224*	probably null	Het
Plekhm2	TTCCTCCTCCT	TTCCTCCT	4: 141,631,981		probably benign	Het
Pomgnt1	C	T	4: 116,137,427		probably benign	Het
Qser1	A	G	2: 104,786,832	C1122R	possibly damaging	Het
Rfx8	A	G	1: 39,683,612	S282P	probably damaging	Het
Sec14l2	C	T	11: 4,103,673		probably null	Het
Sim2	C	A	16: 94,109,422	H228N	probably benign	Het
Slc15a2	A	G	16: 36,772,445	M179T	probably benign	Het
Slc30a6	T	A	17: 74,412,324		probably null	Het
Smarcc1	G	A	9: 110,206,085	E859K	possibly damaging	Het
Snx1	CTT	CTTGTT	9: 66,104,927		probably benign	Het
Spen	A	G	4: 141,474,353	V2321A	probably benign	Het
Spta1	A	G	1: 174,191,066		probably benign	Het
Sytl1	C	A	4: 133,256,851		probably benign	Het
Sytl1	A	G	4: 133,256,853		probably benign	Het
Terf2	T	C	8: 107,076,674	K425E	probably benign	Het
Tmem26	A	G	10: 68,778,718	E321G	probably benign	Het
Toe1	T	C	4: 116,806,093	I62M	probably benign	Het
Uck2	A	T	1: 167,234,711	D149E	probably benign	Het
Wnt5a	G	A	14: 28,511,925	A17T	probably benign	Het
Yif1b	T	C	7: 29,238,613		probably null	Het
Zbtb8a	GG	GGATG	4: 129,360,019		probably benign	Het
Zbtb8a	T	C	4: 129,360,212	H163R	probably benign	Het
Zkscan4	AGAGGAG	AGAG	13: 21,479,200		probably benign	Het
Zmym1	C	T	4: 127,047,947	D785N	probably benign	Het
Zmym1	C	T	4: 127,048,250	V684I	probably benign	Het
Zmym1	A	C	4: 127,049,673	H307Q	probably benign	Het

Other mutations in Klhl14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Klhl14	APN	18	21651864	missense	probably benign	0.00
IGL01474:Klhl14	APN	18	21557854	missense	probably damaging	0.99
IGL02005:Klhl14	APN	18	21624611	nonsense	probably null
IGL02108:Klhl14	APN	18	21557920	missense	probably damaging	0.98
IGL02371:Klhl14	APN	18	21652181	missense	probably damaging	1.00
IGL03354:Klhl14	APN	18	21651728	missense	probably damaging	1.00
P0027:Klhl14	UTSW	18	21558135	missense	probably damaging	1.00
PIT4810001:Klhl14	UTSW	18	21557823	nonsense	probably null
R0288:Klhl14	UTSW	18	21565563	missense	probably damaging	1.00
R1419:Klhl14	UTSW	18	21652193	missense	probably damaging	0.99
R1606:Klhl14	UTSW	18	21565532	missense	possibly damaging	0.94
R1771:Klhl14	UTSW	18	21651620	missense	probably damaging	0.97
R1928:Klhl14	UTSW	18	21651786	missense	probably damaging	1.00
R1966:Klhl14	UTSW	18	21554673	missense	probably damaging	1.00
R3624:Klhl14	UTSW	18	21557896	missense	probably damaging	1.00
R4541:Klhl14	UTSW	18	21554639	nonsense	probably null
R4664:Klhl14	UTSW	18	21554708	missense	probably benign	0.06
R4856:Klhl14	UTSW	18	21557972	intron	probably null
R4886:Klhl14	UTSW	18	21557972	intron	probably null
R4893:Klhl14	UTSW	18	21557935	missense	probably damaging	1.00
R5393:Klhl14	UTSW	18	21651994	missense	probably benign	0.30
R5757:Klhl14	UTSW	18	21554734	missense	probably damaging	1.00
R5951:Klhl14	UTSW	18	21651620	missense	probably damaging	0.97
R5958:Klhl14	UTSW	18	21565535	missense	probably damaging	0.99
R7231:Klhl14	UTSW	18	21652136	missense	probably damaging	0.99
R7519:Klhl14	UTSW	18	21651843	missense	probably benign	0.36
R7527:Klhl14	UTSW	18	21651540	missense	probably damaging	0.99
R7573:Klhl14	UTSW	18	21652154	missense	probably benign	0.00
R7664:Klhl14	UTSW	18	21554649	missense	probably damaging	1.00
R7737:Klhl14	UTSW	18	21558134	nonsense	probably null
X0026:Klhl14	UTSW	18	21651941	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CAAGTAAGTGCCCTGGACAGTGAAC -3'
(R):5'- TCTTTGCATCTCAACAGCAAACGC -3'

Sequencing Primer
(F):5'- ATTGTGCACTGCTCCTGCAT -3'
(R):5'- TGAAGAGACACCCTGCTTTC -3'

Posted On

2013-09-03