Mutagenetix > Incidental Mutation

Incidental Mutation 'R8827:Ryr2'

673562

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

068658-MU

Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8827 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11553102-12106945 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11558048 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 4884 (E4884G)

Ref Sequence

ENSEMBL: ENSMUSP00000021750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

PDB Structure

X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021750
AA Change: E4884G

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: E4884G

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170156
AA Change: E4884G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: E4884G

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Meta Mutation Damage Score

0.7371

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	G	T	6: 96,165,312 (GRCm38)	N250K	probably benign	Het
4932415D10Rik	T	A	10: 82,293,783 (GRCm38)	Q1131L	probably benign	Het
Adamts3	T	C	5: 89,691,465 (GRCm38)	I810V	probably benign	Het
Adcy7	T	C	8: 88,309,699 (GRCm38)	F128S	possibly damaging	Het
Ankhd1	C	T	18: 36,624,580 (GRCm38)	Q188*	probably null	Het
Asxl2	A	T	12: 3,500,501 (GRCm38)	I748L	probably benign	Het
Atp8b2	T	C	3: 89,946,000 (GRCm38)	N70S		Het
Bmp1	A	G	14: 70,490,642 (GRCm38)	Y616H	probably damaging	Het
Brap	T	A	5: 121,672,198 (GRCm38)	D248E	probably benign	Het
Ccdc13	G	A	9: 121,816,699 (GRCm38)	S294L	probably benign	Het
Ccdc130	T	A	8: 84,260,358 (GRCm38)	Q170L	possibly damaging	Het
Cdkl1	T	C	12: 69,747,349 (GRCm38)	Y338C	probably benign	Het
Cfap54	A	T	10: 92,938,248 (GRCm38)	S1993T	unknown	Het
Chl1	G	T	6: 103,693,150 (GRCm38)	M500I	probably benign	Het
Cntn3	G	C	6: 102,269,133 (GRCm38)	L352V	probably benign	Het
Cog6	T	C	3: 52,983,114 (GRCm38)	D635G	probably benign	Het
Col22a1	C	A	15: 71,902,816 (GRCm38)		probably null	Het
Cyp3a16	A	T	5: 145,450,198 (GRCm38)	D327E	probably benign	Het
D6Ertd527e	A	T	6: 87,111,244 (GRCm38)	S130C	unknown	Het
Dhodh	T	C	8: 109,608,296 (GRCm38)		probably benign	Het
Dirc2	A	T	16: 35,733,950 (GRCm38)	C274S	probably benign	Het
Dync2li1	C	T	17: 84,647,651 (GRCm38)	S246L	possibly damaging	Het
Eif3c	A	T	7: 126,558,722 (GRCm38)	F316Y	probably damaging	Het
Esp34	A	T	17: 38,554,200 (GRCm38)		probably benign	Het
Fam98a	T	C	17: 75,544,829 (GRCm38)	M86V	possibly damaging	Het
Gm29394	G	T	15: 58,069,321 (GRCm38)	Q7K	probably damaging	Het
Gtf2i	C	T	5: 134,240,242 (GRCm38)		probably null	Het
Hecw1	A	G	13: 14,264,135 (GRCm38)	Y888H	probably damaging	Het
Hist3h2ba	C	T	11: 58,949,091 (GRCm38)	P51L	probably benign	Het
Kcnma1	A	T	14: 23,367,480 (GRCm38)	W894R	probably damaging	Het
Klhl25	C	A	7: 75,866,643 (GRCm38)	D432E	possibly damaging	Het
Klhl7	G	A	5: 24,158,637 (GRCm38)		probably null	Het
Lamc1	A	T	1: 153,221,678 (GRCm38)	L1540Q	probably damaging	Het
Map3k5	T	A	10: 20,026,257 (GRCm38)	V358E	probably damaging	Het
Map4k5	C	T	12: 69,856,861 (GRCm38)	D57N	possibly damaging	Het
Mpped2	T	C	2: 106,861,583 (GRCm38)	M211T	possibly damaging	Het
Nat9	T	C	11: 115,184,513 (GRCm38)	T101A	probably benign	Het
Nprl3	A	T	11: 32,234,742 (GRCm38)	F447L	probably benign	Het
Olfr1140	C	T	2: 87,746,433 (GRCm38)	P79L	possibly damaging	Het
Olfr1184	T	C	2: 88,486,821 (GRCm38)	S30P	probably damaging	Het
Olfr192	G	A	16: 59,098,698 (GRCm38)	T98I	unknown	Het
Orc3	A	T	4: 34,605,569 (GRCm38)	F104Y	probably benign	Het
Pcdha6	T	A	18: 36,969,749 (GRCm38)	V665E	probably damaging	Het
Pdpk1	T	C	17: 24,088,217 (GRCm38)	D380G	probably benign	Het
Phkg1	T	A	5: 129,865,053 (GRCm38)	E280D	probably benign	Het
Pkdrej	T	A	15: 85,815,531 (GRCm38)	Y2068F	possibly damaging	Het
Plekhg5	A	G	4: 152,107,005 (GRCm38)		probably benign	Het
Plekhh3	G	A	11: 101,167,554 (GRCm38)	P222L	probably damaging	Het
Prdm1	A	T	10: 44,458,480 (GRCm38)	V10E	probably benign	Het
Prdm6	G	T	18: 53,568,195 (GRCm38)	Q513H	probably damaging	Het
Pros1	T	C	16: 62,926,464 (GRCm38)	V593A	probably benign	Het
Radil	T	C	5: 142,508,104 (GRCm38)	H250R	probably damaging	Het
Rasa2	C	T	9: 96,552,350 (GRCm38)	R628Q	probably damaging	Het
Shh	A	G	5: 28,458,127 (GRCm38)	S348P	probably damaging	Het
Slc1a4	A	T	11: 20,320,237 (GRCm38)		probably benign	Het
Slc32a1	A	C	2: 158,611,354 (GRCm38)	D38A	probably damaging	Het
Slc35f3	TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	8: 126,389,041 (GRCm38)		probably benign	Het
Slc45a4	A	T	15: 73,586,467 (GRCm38)	I411N	probably benign	Het
Slc7a10	C	A	7: 35,197,888 (GRCm38)	S248Y	probably damaging	Het
Smc3	T	A	19: 53,622,654 (GRCm38)	D258E	probably benign	Het
Sphk1	A	G	11: 116,535,764 (GRCm38)	D182G	probably damaging	Het
Srgap3	A	G	6: 112,739,341 (GRCm38)	Y633H	probably damaging	Het
Sspo	T	G	6: 48,457,672 (GRCm38)	F1033V	possibly damaging	Het
Syne2	T	C	12: 76,048,583 (GRCm38)	V488A	probably benign	Het
Tead1	A	C	7: 112,876,242 (GRCm38)	K299N	probably damaging	Het
Tmem150c	A	C	5: 100,092,795 (GRCm38)	S69R	probably damaging	Het
Tnfaip3	T	A	10: 19,005,047 (GRCm38)	K424M	probably damaging	Het
Trib3	A	G	2: 152,338,268 (GRCm38)	V335A	possibly damaging	Het
Ttc39c	G	A	18: 12,695,379 (GRCm38)	V199I	probably benign	Het
Vangl1	A	T	3: 102,163,420 (GRCm38)	F400Y	probably damaging	Het
Vmn2r106	A	T	17: 20,267,606 (GRCm38)	S844T	probably benign	Het
Wwtr1	A	G	3: 57,575,195 (GRCm38)	V77A	probably damaging	Het
Zc3h4	C	A	7: 16,429,198 (GRCm38)	P500T	unknown	Het
Zfand2a	C	T	5: 139,474,852 (GRCm38)		probably null	Het
Zfr2	A	G	10: 81,242,785 (GRCm38)	T284A	probably benign	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11,834,092 (GRCm38)	splice site	probably benign
IGL00757:Ryr2	APN	13	11,618,604 (GRCm38)	splice site	probably null
IGL00838:Ryr2	APN	13	11,568,503 (GRCm38)	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11,585,478 (GRCm38)	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11,735,502 (GRCm38)	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11,703,544 (GRCm38)	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11,638,485 (GRCm38)	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11,587,239 (GRCm38)	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11,556,685 (GRCm38)	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11,591,352 (GRCm38)	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11,742,036 (GRCm38)	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11,799,837 (GRCm38)	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11,851,204 (GRCm38)	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11,721,790 (GRCm38)	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11,721,761 (GRCm38)	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11,601,758 (GRCm38)	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11,591,316 (GRCm38)	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11,594,968 (GRCm38)	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11,692,677 (GRCm38)	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11,585,480 (GRCm38)	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11,601,842 (GRCm38)	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11,595,425 (GRCm38)	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11,554,550 (GRCm38)	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11,790,363 (GRCm38)	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11,790,363 (GRCm38)	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11,597,112 (GRCm38)	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11,747,564 (GRCm38)	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11,572,257 (GRCm38)	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11,792,762 (GRCm38)	nonsense	probably null
IGL02086:Ryr2	APN	13	11,735,556 (GRCm38)	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11,759,759 (GRCm38)	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11,737,873 (GRCm38)	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11,741,869 (GRCm38)	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11,730,388 (GRCm38)	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11,747,658 (GRCm38)	splice site	probably benign
IGL02369:Ryr2	APN	13	11,619,496 (GRCm38)	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11,722,721 (GRCm38)	splice site	probably benign
IGL02400:Ryr2	APN	13	11,605,244 (GRCm38)	splice site	probably benign
IGL02423:Ryr2	APN	13	11,745,198 (GRCm38)	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11,745,674 (GRCm38)	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11,705,699 (GRCm38)	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11,554,511 (GRCm38)	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11,605,189 (GRCm38)	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11,738,320 (GRCm38)	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11,655,677 (GRCm38)	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11,595,190 (GRCm38)	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11,707,793 (GRCm38)	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11,918,319 (GRCm38)	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11,591,269 (GRCm38)	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11,759,835 (GRCm38)	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11,684,479 (GRCm38)	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11,643,902 (GRCm38)	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11,635,582 (GRCm38)	splice site	probably benign
IGL03152:Ryr2	APN	13	11,853,150 (GRCm38)	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11,742,023 (GRCm38)	nonsense	probably null
IGL03180:Ryr2	APN	13	11,568,563 (GRCm38)	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11,724,387 (GRCm38)	splice site	probably benign
IGL03390:Ryr2	APN	13	11,772,416 (GRCm38)	missense	probably benign
IGL03410:Ryr2	APN	13	11,588,147 (GRCm38)	missense	probably damaging	0.99
Arruda	UTSW	13	11,643,895 (GRCm38)	missense	probably damaging	1.00
Arruda2	UTSW	13	11,879,496 (GRCm38)	missense	probably damaging	1.00
Arruda3	UTSW	13	11,555,448 (GRCm38)	missense	possibly damaging	0.91
barricuda	UTSW	13	11,595,014 (GRCm38)	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11,690,295 (GRCm38)	nonsense	probably null
BB006:Ryr2	UTSW	13	11,594,794 (GRCm38)	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11,690,295 (GRCm38)	nonsense	probably null
BB016:Ryr2	UTSW	13	11,594,794 (GRCm38)	missense	probably damaging	1.00
H8562:Ryr2	UTSW	13	11,717,141 (GRCm38)	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11,665,962 (GRCm38)	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11,761,306 (GRCm38)	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11,707,796 (GRCm38)	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11,594,755 (GRCm38)	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11,555,448 (GRCm38)	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11,824,379 (GRCm38)	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11,665,919 (GRCm38)	missense	probably benign
R0018:Ryr2	UTSW	13	11,595,223 (GRCm38)	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11,595,784 (GRCm38)	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11,595,784 (GRCm38)	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11,669,038 (GRCm38)	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11,869,116 (GRCm38)	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11,869,116 (GRCm38)	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11,568,475 (GRCm38)	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11,709,921 (GRCm38)	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11,714,548 (GRCm38)	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11,676,251 (GRCm38)	splice site	probably benign
R0226:Ryr2	UTSW	13	11,772,556 (GRCm38)	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11,716,977 (GRCm38)	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11,668,839 (GRCm38)	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11,705,684 (GRCm38)	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11,869,156 (GRCm38)	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11,834,095 (GRCm38)	splice site	probably benign
R0558:Ryr2	UTSW	13	11,799,861 (GRCm38)	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11,638,443 (GRCm38)	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11,731,669 (GRCm38)	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11,635,559 (GRCm38)	missense	probably null
R0601:Ryr2	UTSW	13	11,705,633 (GRCm38)	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11,622,952 (GRCm38)	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11,724,333 (GRCm38)	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11,566,885 (GRCm38)	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11,554,529 (GRCm38)	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11,738,126 (GRCm38)	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11,554,529 (GRCm38)	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11,669,969 (GRCm38)	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11,945,981 (GRCm38)	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11,660,113 (GRCm38)	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11,759,703 (GRCm38)	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11,883,043 (GRCm38)	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11,687,879 (GRCm38)	splice site	probably benign
R1400:Ryr2	UTSW	13	11,595,076 (GRCm38)	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11,714,503 (GRCm38)	splice site	probably benign
R1443:Ryr2	UTSW	13	11,779,266 (GRCm38)	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11,738,149 (GRCm38)	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11,727,022 (GRCm38)	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11,601,841 (GRCm38)	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11,554,592 (GRCm38)	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11,554,549 (GRCm38)	nonsense	probably null
R1551:Ryr2	UTSW	13	11,785,143 (GRCm38)	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11,759,677 (GRCm38)	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11,794,563 (GRCm38)	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11,718,482 (GRCm38)	nonsense	probably null
R1686:Ryr2	UTSW	13	11,603,779 (GRCm38)	splice site	probably benign
R1696:Ryr2	UTSW	13	11,731,657 (GRCm38)	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11,587,442 (GRCm38)	splice site	probably null
R1728:Ryr2	UTSW	13	11,587,422 (GRCm38)	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11,790,267 (GRCm38)	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11,745,176 (GRCm38)	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11,745,176 (GRCm38)	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11,700,371 (GRCm38)	nonsense	probably null
R1801:Ryr2	UTSW	13	11,595,281 (GRCm38)	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11,560,586 (GRCm38)	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11,587,316 (GRCm38)	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11,769,878 (GRCm38)	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11,731,700 (GRCm38)	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11,662,075 (GRCm38)	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11,738,356 (GRCm38)	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11,658,958 (GRCm38)	nonsense	probably null
R1897:Ryr2	UTSW	13	11,750,932 (GRCm38)	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11,591,336 (GRCm38)	missense	probably benign
R1909:Ryr2	UTSW	13	11,700,349 (GRCm38)	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11,556,698 (GRCm38)	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11,668,962 (GRCm38)	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11,731,723 (GRCm38)	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11,681,080 (GRCm38)	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11,585,402 (GRCm38)	splice site	probably null
R2018:Ryr2	UTSW	13	11,851,188 (GRCm38)	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11,851,188 (GRCm38)	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11,595,736 (GRCm38)	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11,665,878 (GRCm38)	splice site	probably null
R2088:Ryr2	UTSW	13	11,662,229 (GRCm38)	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11,945,977 (GRCm38)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,945,977 (GRCm38)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,945,977 (GRCm38)	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11,712,195 (GRCm38)	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11,560,607 (GRCm38)	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11,577,873 (GRCm38)	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11,705,793 (GRCm38)	nonsense	probably null
R2207:Ryr2	UTSW	13	11,810,937 (GRCm38)	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11,662,260 (GRCm38)	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11,738,216 (GRCm38)	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11,738,242 (GRCm38)	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11,591,237 (GRCm38)	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11,801,848 (GRCm38)	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11,759,703 (GRCm38)	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11,593,093 (GRCm38)	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11,593,093 (GRCm38)	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11,761,349 (GRCm38)	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11,761,349 (GRCm38)	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11,772,580 (GRCm38)	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11,588,159 (GRCm38)	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11,738,209 (GRCm38)	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11,772,427 (GRCm38)	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11,918,414 (GRCm38)	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11,692,682 (GRCm38)	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11,779,267 (GRCm38)	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11,587,437 (GRCm38)	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11,737,873 (GRCm38)	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11,750,725 (GRCm38)	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11,649,812 (GRCm38)	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11,605,233 (GRCm38)	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11,717,066 (GRCm38)	nonsense	probably null
R4430:Ryr2	UTSW	13	11,735,527 (GRCm38)	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12,106,415 (GRCm38)	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11,749,509 (GRCm38)	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11,750,685 (GRCm38)	splice site	probably null
R4668:Ryr2	UTSW	13	11,593,117 (GRCm38)	missense	probably benign
R4677:Ryr2	UTSW	13	11,706,667 (GRCm38)	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11,824,369 (GRCm38)	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11,595,233 (GRCm38)	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11,692,646 (GRCm38)	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11,716,998 (GRCm38)	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11,577,909 (GRCm38)	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11,577,909 (GRCm38)	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11,577,909 (GRCm38)	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11,737,753 (GRCm38)	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11,657,047 (GRCm38)	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11,708,227 (GRCm38)	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11,687,932 (GRCm38)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,687,932 (GRCm38)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,708,227 (GRCm38)	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11,717,097 (GRCm38)	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11,655,698 (GRCm38)	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11,745,752 (GRCm38)	missense	probably damaging	1.00
R4850:Ryr2	UTSW	13	11,668,820 (GRCm38)	missense	probably damaging	0.99
R4880:Ryr2	UTSW	13	11,752,218 (GRCm38)	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11,594,986 (GRCm38)	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11,594,986 (GRCm38)	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11,709,963 (GRCm38)	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11,945,945 (GRCm38)	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11,742,011 (GRCm38)	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11,785,080 (GRCm38)	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11,833,992 (GRCm38)	missense	probably benign	0.00
R4964:Ryr2	UTSW	13	11,714,611 (GRCm38)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,714,611 (GRCm38)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,833,992 (GRCm38)	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11,595,306 (GRCm38)	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11,643,895 (GRCm38)	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11,587,254 (GRCm38)	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11,635,536 (GRCm38)	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11,700,354 (GRCm38)	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11,712,243 (GRCm38)	nonsense	probably null
R5135:Ryr2	UTSW	13	11,662,130 (GRCm38)	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11,660,289 (GRCm38)	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11,752,321 (GRCm38)	missense	probably benign
R5187:Ryr2	UTSW	13	11,772,452 (GRCm38)	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11,638,430 (GRCm38)	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11,772,437 (GRCm38)	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11,690,363 (GRCm38)	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11,556,658 (GRCm38)	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11,655,713 (GRCm38)	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11,705,656 (GRCm38)	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11,705,701 (GRCm38)	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11,745,601 (GRCm38)	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11,687,909 (GRCm38)	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11,555,448 (GRCm38)	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11,595,014 (GRCm38)	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11,708,202 (GRCm38)	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11,601,805 (GRCm38)	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11,595,582 (GRCm38)	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11,759,836 (GRCm38)	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11,769,962 (GRCm38)	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11,603,732 (GRCm38)	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11,560,574 (GRCm38)	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11,584,154 (GRCm38)	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11,790,332 (GRCm38)	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11,687,902 (GRCm38)	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11,660,122 (GRCm38)	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11,726,953 (GRCm38)	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11,662,238 (GRCm38)	nonsense	probably null
R5974:Ryr2	UTSW	13	11,714,511 (GRCm38)	splice site	probably null
R6104:Ryr2	UTSW	13	11,799,825 (GRCm38)	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11,792,689 (GRCm38)	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11,669,017 (GRCm38)	missense	probably benign
R6208:Ryr2	UTSW	13	11,895,220 (GRCm38)	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11,834,078 (GRCm38)	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11,660,107 (GRCm38)	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11,680,999 (GRCm38)	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11,879,496 (GRCm38)	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11,680,999 (GRCm38)	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11,761,396 (GRCm38)	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11,662,383 (GRCm38)	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11,834,007 (GRCm38)	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11,668,821 (GRCm38)	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11,594,723 (GRCm38)	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11,710,065 (GRCm38)	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11,595,643 (GRCm38)	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11,594,723 (GRCm38)	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11,738,462 (GRCm38)	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11,686,966 (GRCm38)	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11,726,930 (GRCm38)	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11,829,654 (GRCm38)	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11,827,559 (GRCm38)	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11,745,601 (GRCm38)	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11,566,948 (GRCm38)	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11,801,243 (GRCm38)	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11,654,380 (GRCm38)	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11,712,166 (GRCm38)	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11,794,605 (GRCm38)	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11,824,400 (GRCm38)	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11,649,776 (GRCm38)	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11,669,987 (GRCm38)	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11,655,713 (GRCm38)	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11,668,811 (GRCm38)	critical splice donor site	probably null
R7131:Ryr2	UTSW	13	11,640,327 (GRCm38)	missense	possibly damaging	0.63
R7159:Ryr2	UTSW	13	11,810,908 (GRCm38)	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11,801,177 (GRCm38)	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11,686,978 (GRCm38)	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11,759,757 (GRCm38)	missense	probably benign
R7189:Ryr2	UTSW	13	11,883,123 (GRCm38)	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11,665,913 (GRCm38)	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11,597,146 (GRCm38)	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11,738,194 (GRCm38)	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11,745,631 (GRCm38)	missense	probably benign
R7365:Ryr2	UTSW	13	11,640,275 (GRCm38)	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11,680,999 (GRCm38)	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11,785,111 (GRCm38)	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11,735,620 (GRCm38)	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11,556,748 (GRCm38)	splice site	probably null
R7425:Ryr2	UTSW	13	11,705,644 (GRCm38)	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11,555,463 (GRCm38)	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11,752,282 (GRCm38)	missense	probably benign
R7460:Ryr2	UTSW	13	11,705,710 (GRCm38)	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11,594,876 (GRCm38)	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11,638,431 (GRCm38)	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11,737,985 (GRCm38)	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11,799,825 (GRCm38)	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11,560,653 (GRCm38)	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11,761,327 (GRCm38)	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11,761,315 (GRCm38)	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11,690,333 (GRCm38)	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11,730,343 (GRCm38)	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11,751,011 (GRCm38)	missense	probably benign
R7797:Ryr2	UTSW	13	11,801,180 (GRCm38)	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11,827,607 (GRCm38)	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11,706,623 (GRCm38)	nonsense	probably null
R7872:Ryr2	UTSW	13	11,595,724 (GRCm38)	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11,792,748 (GRCm38)	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11,594,794 (GRCm38)	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11,690,295 (GRCm38)	nonsense	probably null
R7952:Ryr2	UTSW	13	11,646,427 (GRCm38)	splice site	probably null
R8008:Ryr2	UTSW	13	11,657,094 (GRCm38)	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11,588,140 (GRCm38)	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11,945,995 (GRCm38)	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11,603,698 (GRCm38)	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11,827,553 (GRCm38)	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11,595,506 (GRCm38)	nonsense	probably null
R8351:Ryr2	UTSW	13	11,799,832 (GRCm38)	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11,668,935 (GRCm38)	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11,684,478 (GRCm38)	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11,659,008 (GRCm38)	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11,577,778 (GRCm38)	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11,560,593 (GRCm38)	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11,687,989 (GRCm38)	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11,686,947 (GRCm38)	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11,668,969 (GRCm38)	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11,735,623 (GRCm38)	missense	possibly damaging	0.95
R8884:Ryr2	UTSW	13	11,779,266 (GRCm38)	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11,785,104 (GRCm38)	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11,799,882 (GRCm38)	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11,595,038 (GRCm38)	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11,603,732 (GRCm38)	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11,594,786 (GRCm38)	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11,738,103 (GRCm38)	nonsense	probably null
R9056:Ryr2	UTSW	13	11,595,931 (GRCm38)	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11,601,838 (GRCm38)	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11,603,855 (GRCm38)	intron	probably benign
R9116:Ryr2	UTSW	13	11,572,299 (GRCm38)	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11,654,406 (GRCm38)	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11,885,538 (GRCm38)	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11,829,674 (GRCm38)	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11,829,674 (GRCm38)	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11,595,886 (GRCm38)	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11,883,116 (GRCm38)	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11,750,968 (GRCm38)	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11,883,090 (GRCm38)	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11,883,090 (GRCm38)	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11,706,692 (GRCm38)	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11,883,116 (GRCm38)	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11,681,087 (GRCm38)	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11,794,573 (GRCm38)	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11,772,577 (GRCm38)	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11,737,794 (GRCm38)	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11,556,604 (GRCm38)	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11,587,215 (GRCm38)	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11,745,218 (GRCm38)	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11,668,962 (GRCm38)	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11,722,760 (GRCm38)	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11,687,049 (GRCm38)	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11,594,899 (GRCm38)	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11,692,713 (GRCm38)	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11,869,156 (GRCm38)	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11,703,501 (GRCm38)	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11,643,803 (GRCm38)	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11,598,611 (GRCm38)	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11,794,549 (GRCm38)	nonsense	probably null
Z1177:Ryr2	UTSW	13	11,750,873 (GRCm38)	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TGCCAAGTGGTCTATGCATAGG -3'
(R):5'- GAAGCAGCCAGTATGACGTC -3'

Sequencing Primer
(F):5'- GTCTATGCATAGGCCAGAAGG -3'
(R):5'- GCCAGTATGACGTCAGACTTC -3'

Posted On

2021-07-15