Incidental Mutation 'R8827:Bmp1'
ID 673565
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 068658-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8827 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70728082 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 616 (Y616H)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably damaging
Transcript: ENSMUST00000022693
AA Change: Y616H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: Y616H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,839,324 (GRCm39) I810V probably benign Het
Adcy7 T C 8: 89,036,327 (GRCm39) F128S possibly damaging Het
Ankhd1 C T 18: 36,757,633 (GRCm39) Q188* probably null Het
Asxl2 A T 12: 3,550,501 (GRCm39) I748L probably benign Het
Atp8b2 T C 3: 89,853,307 (GRCm39) N70S Het
Brap T A 5: 121,810,261 (GRCm39) D248E probably benign Het
Ccdc13 G A 9: 121,645,765 (GRCm39) S294L probably benign Het
Cdkl1 T C 12: 69,794,123 (GRCm39) Y338C probably benign Het
Cfap54 A T 10: 92,774,110 (GRCm39) S1993T unknown Het
Chl1 G T 6: 103,670,111 (GRCm39) M500I probably benign Het
Cntn3 G C 6: 102,246,094 (GRCm39) L352V probably benign Het
Cog6 T C 3: 52,890,535 (GRCm39) D635G probably benign Het
Col22a1 C A 15: 71,774,665 (GRCm39) probably null Het
Cyp3a16 A T 5: 145,387,008 (GRCm39) D327E probably benign Het
D6Ertd527e A T 6: 87,088,226 (GRCm39) S130C unknown Het
Dhodh T C 8: 110,334,928 (GRCm39) probably benign Het
Dync2li1 C T 17: 84,955,079 (GRCm39) S246L possibly damaging Het
Eif3c A T 7: 126,157,894 (GRCm39) F316Y probably damaging Het
Esp34 A T 17: 38,865,091 (GRCm39) probably benign Het
Fam98a T C 17: 75,851,824 (GRCm39) M86V possibly damaging Het
Gm29394 G T 15: 57,932,717 (GRCm39) Q7K probably damaging Het
Gtf2i C T 5: 134,269,096 (GRCm39) probably null Het
H2bc27 C T 11: 58,839,917 (GRCm39) P51L probably benign Het
Hecw1 A G 13: 14,438,720 (GRCm39) Y888H probably damaging Het
Kcnma1 A T 14: 23,417,548 (GRCm39) W894R probably damaging Het
Klhl25 C A 7: 75,516,391 (GRCm39) D432E possibly damaging Het
Klhl7 G A 5: 24,363,635 (GRCm39) probably null Het
Lamc1 A T 1: 153,097,424 (GRCm39) L1540Q probably damaging Het
Map3k5 T A 10: 19,902,003 (GRCm39) V358E probably damaging Het
Map4k5 C T 12: 69,903,635 (GRCm39) D57N possibly damaging Het
Mpped2 T C 2: 106,691,928 (GRCm39) M211T possibly damaging Het
Nat9 T C 11: 115,075,339 (GRCm39) T101A probably benign Het
Nprl3 A T 11: 32,184,742 (GRCm39) F447L probably benign Het
Nup50l G T 6: 96,142,293 (GRCm39) N250K probably benign Het
Or4p22 T C 2: 88,317,165 (GRCm39) S30P probably damaging Het
Or5h24 G A 16: 58,919,061 (GRCm39) T98I unknown Het
Or5w16 C T 2: 87,576,777 (GRCm39) P79L possibly damaging Het
Orc3 A T 4: 34,605,569 (GRCm39) F104Y probably benign Het
Pcdha6 T A 18: 37,102,802 (GRCm39) V665E probably damaging Het
Pdpk1 T C 17: 24,307,191 (GRCm39) D380G probably benign Het
Phkg1 T A 5: 129,893,894 (GRCm39) E280D probably benign Het
Pkdrej T A 15: 85,699,732 (GRCm39) Y2068F possibly damaging Het
Plekhg5 A G 4: 152,191,462 (GRCm39) probably benign Het
Plekhh3 G A 11: 101,058,380 (GRCm39) P222L probably damaging Het
Prdm1 A T 10: 44,334,476 (GRCm39) V10E probably benign Het
Prdm6 G T 18: 53,701,267 (GRCm39) Q513H probably damaging Het
Pros1 T C 16: 62,746,827 (GRCm39) V593A probably benign Het
Radil T C 5: 142,493,859 (GRCm39) H250R probably damaging Het
Rasa2 C T 9: 96,434,403 (GRCm39) R628Q probably damaging Het
Ryr2 T C 13: 11,572,934 (GRCm39) E4884G possibly damaging Het
Shh A G 5: 28,663,125 (GRCm39) S348P probably damaging Het
Slc1a4 A T 11: 20,270,237 (GRCm39) probably benign Het
Slc32a1 A C 2: 158,453,274 (GRCm39) D38A probably damaging Het
Slc35f3 TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,780 (GRCm39) probably benign Het
Slc45a4 A T 15: 73,458,316 (GRCm39) I411N probably benign Het
Slc49a4 A T 16: 35,554,320 (GRCm39) C274S probably benign Het
Slc7a10 C A 7: 34,897,313 (GRCm39) S248Y probably damaging Het
Smc3 T A 19: 53,611,085 (GRCm39) D258E probably benign Het
Spata31h1 T A 10: 82,129,617 (GRCm39) Q1131L probably benign Het
Sphk1 A G 11: 116,426,590 (GRCm39) D182G probably damaging Het
Srgap3 A G 6: 112,716,302 (GRCm39) Y633H probably damaging Het
Sspo T G 6: 48,434,606 (GRCm39) F1033V possibly damaging Het
Syne2 T C 12: 76,095,357 (GRCm39) V488A probably benign Het
Tead1 A C 7: 112,475,449 (GRCm39) K299N probably damaging Het
Tmem150c A C 5: 100,240,654 (GRCm39) S69R probably damaging Het
Tnfaip3 T A 10: 18,880,795 (GRCm39) K424M probably damaging Het
Trib3 A G 2: 152,180,188 (GRCm39) V335A possibly damaging Het
Ttc39c G A 18: 12,828,436 (GRCm39) V199I probably benign Het
Vangl1 A T 3: 102,070,736 (GRCm39) F400Y probably damaging Het
Vmn2r106 A T 17: 20,487,868 (GRCm39) S844T probably benign Het
Wwtr1 A G 3: 57,482,616 (GRCm39) V77A probably damaging Het
Yju2b T A 8: 84,986,987 (GRCm39) Q170L possibly damaging Het
Zc3h4 C A 7: 16,163,123 (GRCm39) P500T unknown Het
Zfand2a C T 5: 139,460,607 (GRCm39) probably null Het
Zfr2 A G 10: 81,078,619 (GRCm39) T284A probably benign Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCTCTGAGCTTCTGTG -3'
(R):5'- TCCAAGGCCCCTACTATCTG -3'

Sequencing Primer
(F):5'- TTATCTAATTCTCCCAGTGGTAGG -3'
(R):5'- GCCCCATGCCTCCAAATTGTG -3'
Posted On 2021-07-15