Incidental Mutation 'R8827:Bmp1'
ID 673565
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8827 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70474558-70520234 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70490642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 616 (Y616H)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably damaging
Transcript: ENSMUST00000022693
AA Change: Y616H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: Y616H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,312 N250K probably benign Het
4932415D10Rik T A 10: 82,293,783 Q1131L probably benign Het
Adamts3 T C 5: 89,691,465 I810V probably benign Het
Adcy7 T C 8: 88,309,699 F128S possibly damaging Het
Ankhd1 C T 18: 36,624,580 Q188* probably null Het
Asxl2 A T 12: 3,500,501 I748L probably benign Het
Atp8b2 T C 3: 89,946,000 N70S Het
Brap T A 5: 121,672,198 D248E probably benign Het
Ccdc13 G A 9: 121,816,699 S294L probably benign Het
Ccdc130 T A 8: 84,260,358 Q170L possibly damaging Het
Cdkl1 T C 12: 69,747,349 Y338C probably benign Het
Cfap54 A T 10: 92,938,248 S1993T unknown Het
Chl1 G T 6: 103,693,150 M500I probably benign Het
Cntn3 G C 6: 102,269,133 L352V probably benign Het
Cog6 T C 3: 52,983,114 D635G probably benign Het
Col22a1 C A 15: 71,902,816 probably null Het
Cyp3a16 A T 5: 145,450,198 D327E probably benign Het
D6Ertd527e A T 6: 87,111,244 S130C unknown Het
Dhodh T C 8: 109,608,296 probably benign Het
Dirc2 A T 16: 35,733,950 C274S probably benign Het
Dync2li1 C T 17: 84,647,651 S246L possibly damaging Het
Eif3c A T 7: 126,558,722 F316Y probably damaging Het
Esp34 A T 17: 38,554,200 probably benign Het
Fam98a T C 17: 75,544,829 M86V possibly damaging Het
Gm29394 G T 15: 58,069,321 Q7K probably damaging Het
Gtf2i C T 5: 134,240,242 probably null Het
Hecw1 A G 13: 14,264,135 Y888H probably damaging Het
Hist3h2ba C T 11: 58,949,091 P51L probably benign Het
Kcnma1 A T 14: 23,367,480 W894R probably damaging Het
Klhl25 C A 7: 75,866,643 D432E possibly damaging Het
Klhl7 G A 5: 24,158,637 probably null Het
Lamc1 A T 1: 153,221,678 L1540Q probably damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Map4k5 C T 12: 69,856,861 D57N possibly damaging Het
Mpped2 T C 2: 106,861,583 M211T possibly damaging Het
Nat9 T C 11: 115,184,513 T101A probably benign Het
Nprl3 A T 11: 32,234,742 F447L probably benign Het
Olfr1140 C T 2: 87,746,433 P79L possibly damaging Het
Olfr1184 T C 2: 88,486,821 S30P probably damaging Het
Olfr192 G A 16: 59,098,698 T98I unknown Het
Orc3 A T 4: 34,605,569 F104Y probably benign Het
Pcdha6 T A 18: 36,969,749 V665E probably damaging Het
Pdpk1 T C 17: 24,088,217 D380G probably benign Het
Phkg1 T A 5: 129,865,053 E280D probably benign Het
Pkdrej T A 15: 85,815,531 Y2068F possibly damaging Het
Plekhg5 A G 4: 152,107,005 probably benign Het
Plekhh3 G A 11: 101,167,554 P222L probably damaging Het
Prdm1 A T 10: 44,458,480 V10E probably benign Het
Prdm6 G T 18: 53,568,195 Q513H probably damaging Het
Pros1 T C 16: 62,926,464 V593A probably benign Het
Radil T C 5: 142,508,104 H250R probably damaging Het
Rasa2 C T 9: 96,552,350 R628Q probably damaging Het
Ryr2 T C 13: 11,558,048 E4884G possibly damaging Het
Shh A G 5: 28,458,127 S348P probably damaging Het
Slc1a4 A T 11: 20,320,237 probably benign Het
Slc32a1 A C 2: 158,611,354 D38A probably damaging Het
Slc35f3 TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,041 probably benign Het
Slc45a4 A T 15: 73,586,467 I411N probably benign Het
Slc7a10 C A 7: 35,197,888 S248Y probably damaging Het
Smc3 T A 19: 53,622,654 D258E probably benign Het
Sphk1 A G 11: 116,535,764 D182G probably damaging Het
Srgap3 A G 6: 112,739,341 Y633H probably damaging Het
Sspo T G 6: 48,457,672 F1033V possibly damaging Het
Syne2 T C 12: 76,048,583 V488A probably benign Het
Tead1 A C 7: 112,876,242 K299N probably damaging Het
Tmem150c A C 5: 100,092,795 S69R probably damaging Het
Tnfaip3 T A 10: 19,005,047 K424M probably damaging Het
Trib3 A G 2: 152,338,268 V335A possibly damaging Het
Ttc39c G A 18: 12,695,379 V199I probably benign Het
Vangl1 A T 3: 102,163,420 F400Y probably damaging Het
Vmn2r106 A T 17: 20,267,606 S844T probably benign Het
Wwtr1 A G 3: 57,575,195 V77A probably damaging Het
Zc3h4 C A 7: 16,429,198 P500T unknown Het
Zfand2a C T 5: 139,474,852 probably null Het
Zfr2 A G 10: 81,242,785 T284A probably benign Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70492461 missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70486220 missense probably damaging 0.97
IGL02065:Bmp1 APN 14 70490107 missense probably damaging 0.99
IGL02349:Bmp1 APN 14 70507549 missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70504776 missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70490029 missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70490034 missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70508004 missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70486265 missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70508831 missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70486272 missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70492107 missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70490542 splice site probably null
R4609:Bmp1 UTSW 14 70477966 missense probably benign 0.00
R4613:Bmp1 UTSW 14 70508523 missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70492844 missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70492073 splice site probably null
R4884:Bmp1 UTSW 14 70475215 missense probably benign 0.01
R4905:Bmp1 UTSW 14 70491362 missense probably benign 0.06
R5088:Bmp1 UTSW 14 70486219 missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70480165 missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70508128 missense probably benign 0.34
R5625:Bmp1 UTSW 14 70486166 missense probably benign 0.19
R5653:Bmp1 UTSW 14 70490094 missense probably benign 0.00
R6155:Bmp1 UTSW 14 70508007 missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70491383 missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70491368 missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70508858 missense probably benign 0.26
R6983:Bmp1 UTSW 14 70508207 missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70479560 missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70490122 missense probably benign 0.44
R7716:Bmp1 UTSW 14 70477922 nonsense probably null
R7749:Bmp1 UTSW 14 70492844 missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70492084 missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70508565 missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70519889 missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70490133 missense possibly damaging 0.94
R8945:Bmp1 UTSW 14 70490190 missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70490173 missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70519898 missense probably benign
X0028:Bmp1 UTSW 14 70508537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCTCTGAGCTTCTGTG -3'
(R):5'- TCCAAGGCCCCTACTATCTG -3'

Sequencing Primer
(F):5'- TTATCTAATTCTCCCAGTGGTAGG -3'
(R):5'- GCCCCATGCCTCCAAATTGTG -3'
Posted On 2021-07-15