Incidental Mutation 'R8827:Prdm6'
ID673581
Institutional Source Beutler Lab
Gene Symbol Prdm6
Ensembl Gene ENSMUSG00000069378
Gene NamePR domain containing 6
SynonymsLOC225518, PRISM
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R8827 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location53464546-53575907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53568195 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 513 (Q513H)
Ref Sequence ENSEMBL: ENSMUSP00000089513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091900] [ENSMUST00000115398] [ENSMUST00000115399] [ENSMUST00000154557]
Predicted Effect probably damaging
Transcript: ENSMUST00000091900
AA Change: Q513H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089513
Gene: ENSMUSG00000069378
AA Change: Q513H

DomainStartEndE-ValueType
low complexity region 26 73 N/A INTRINSIC
low complexity region 77 113 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
low complexity region 229 236 N/A INTRINSIC
SET 249 372 1.98e-3 SMART
ZnF_C2H2 474 494 1.24e2 SMART
ZnF_C2H2 502 524 1.58e-3 SMART
ZnF_C2H2 530 552 1.47e-3 SMART
ZnF_C2H2 558 578 1.2e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115398
AA Change: Q121H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111056
Gene: ENSMUSG00000069378
AA Change: Q121H

DomainStartEndE-ValueType
ZnF_C2H2 82 102 1.24e2 SMART
ZnF_C2H2 110 132 1.58e-3 SMART
ZnF_C2H2 138 160 1.47e-3 SMART
ZnF_C2H2 166 186 1.2e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115399
AA Change: Q312H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111057
Gene: ENSMUSG00000069378
AA Change: Q312H

DomainStartEndE-ValueType
low complexity region 28 35 N/A INTRINSIC
SET 48 171 1.98e-3 SMART
ZnF_C2H2 273 293 1.24e2 SMART
ZnF_C2H2 301 323 1.58e-3 SMART
ZnF_C2H2 329 351 1.47e-3 SMART
ZnF_C2H2 357 377 1.2e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154557
AA Change: Q352H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114644
Gene: ENSMUSG00000069378
AA Change: Q352H

DomainStartEndE-ValueType
low complexity region 68 75 N/A INTRINSIC
SET 88 211 1.98e-3 SMART
ZnF_C2H2 313 333 1.24e2 SMART
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 417 1.2e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiovascular development defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,312 N250K probably benign Het
4932415D10Rik T A 10: 82,293,783 Q1131L probably benign Het
Adamts3 T C 5: 89,691,465 I810V probably benign Het
Adcy7 T C 8: 88,309,699 F128S possibly damaging Het
Ankhd1 C T 18: 36,624,580 Q188* probably null Het
Asxl2 A T 12: 3,500,501 I748L probably benign Het
Atp8b2 T C 3: 89,946,000 N70S Het
Bmp1 A G 14: 70,490,642 Y616H probably damaging Het
Brap T A 5: 121,672,198 D248E probably benign Het
Ccdc13 G A 9: 121,816,699 S294L probably benign Het
Ccdc130 T A 8: 84,260,358 Q170L possibly damaging Het
Cdkl1 T C 12: 69,747,349 Y338C probably benign Het
Cfap54 A T 10: 92,938,248 S1993T unknown Het
Chl1 G T 6: 103,693,150 M500I probably benign Het
Cntn3 G C 6: 102,269,133 L352V probably benign Het
Cog6 T C 3: 52,983,114 D635G probably benign Het
Col22a1 C A 15: 71,902,816 probably null Het
Cyp3a16 A T 5: 145,450,198 D327E probably benign Het
D6Ertd527e A T 6: 87,111,244 S130C unknown Het
Dirc2 A T 16: 35,733,950 C274S probably benign Het
Dync2li1 C T 17: 84,647,651 S246L possibly damaging Het
Eif3c A T 7: 126,558,722 F316Y probably damaging Het
Esp34 A T 17: 38,554,200 probably benign Het
Fam98a T C 17: 75,544,829 M86V possibly damaging Het
Gm29394 G T 15: 58,069,321 Q7K probably damaging Het
Gtf2i C T 5: 134,240,242 probably null Het
Hecw1 A G 13: 14,264,135 Y888H probably damaging Het
Hist3h2ba C T 11: 58,949,091 P51L probably benign Het
Kcnma1 A T 14: 23,367,480 W894R probably damaging Het
Klhl25 C A 7: 75,866,643 D432E possibly damaging Het
Klhl7 G A 5: 24,158,637 probably null Het
Lamc1 A T 1: 153,221,678 L1540Q probably damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Map4k5 C T 12: 69,856,861 D57N possibly damaging Het
Mpped2 T C 2: 106,861,583 M211T possibly damaging Het
Nat9 T C 11: 115,184,513 T101A probably benign Het
Nprl3 A T 11: 32,234,742 F447L probably benign Het
Olfr1140 C T 2: 87,746,433 P79L possibly damaging Het
Olfr1184 T C 2: 88,486,821 S30P probably damaging Het
Olfr192 G A 16: 59,098,698 T98I unknown Het
Orc3 A T 4: 34,605,569 F104Y probably benign Het
Pcdha6 T A 18: 36,969,749 V665E probably damaging Het
Pdpk1 T C 17: 24,088,217 D380G probably benign Het
Phkg1 T A 5: 129,865,053 E280D probably benign Het
Pkdrej T A 15: 85,815,531 Y2068F possibly damaging Het
Plekhh3 G A 11: 101,167,554 P222L probably damaging Het
Prdm1 A T 10: 44,458,480 V10E probably benign Het
Pros1 T C 16: 62,926,464 V593A probably benign Het
Radil T C 5: 142,508,104 H250R probably damaging Het
Rasa2 C T 9: 96,552,350 R628Q probably damaging Het
Ryr2 T C 13: 11,558,048 E4884G possibly damaging Het
Shh A G 5: 28,458,127 S348P probably damaging Het
Slc32a1 A C 2: 158,611,354 D38A probably damaging Het
Slc35f3 TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,041 probably benign Het
Slc45a4 A T 15: 73,586,467 I411N probably benign Het
Slc7a10 C A 7: 35,197,888 S248Y probably damaging Het
Smc3 T A 19: 53,622,654 D258E probably benign Het
Sphk1 A G 11: 116,535,764 D182G probably damaging Het
Srgap3 A G 6: 112,739,341 Y633H probably damaging Het
Sspo T G 6: 48,457,672 F1033V possibly damaging Het
Syne2 T C 12: 76,048,583 V488A probably benign Het
Tead1 A C 7: 112,876,242 K299N probably damaging Het
Tmem150c A C 5: 100,092,795 S69R probably damaging Het
Tnfaip3 T A 10: 19,005,047 K424M probably damaging Het
Trib3 A G 2: 152,338,268 V335A possibly damaging Het
Ttc39c G A 18: 12,695,379 V199I probably benign Het
Vangl1 A T 3: 102,163,420 F400Y probably damaging Het
Vmn2r106 A T 17: 20,267,606 S844T probably benign Het
Wwtr1 A G 3: 57,575,195 V77A probably damaging Het
Zc3h4 C A 7: 16,429,198 P500T unknown Het
Zfand2a C T 5: 139,474,852 probably null Het
Zfr2 A G 10: 81,242,785 T284A probably benign Het
Other mutations in Prdm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Prdm6 APN 18 53540285 missense probably benign 0.08
IGL00743:Prdm6 APN 18 53540228 missense possibly damaging 0.84
IGL02183:Prdm6 APN 18 53464677 unclassified probably benign
R1720:Prdm6 UTSW 18 53540200 missense probably benign 0.29
R1879:Prdm6 UTSW 18 53568217 missense probably damaging 1.00
R1950:Prdm6 UTSW 18 53536724 missense possibly damaging 0.90
R1962:Prdm6 UTSW 18 53568161 missense probably damaging 1.00
R2022:Prdm6 UTSW 18 53464959 unclassified probably benign
R3973:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3974:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3975:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3976:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R4012:Prdm6 UTSW 18 53540318 missense possibly damaging 0.70
R5144:Prdm6 UTSW 18 53465038 unclassified probably benign
R5640:Prdm6 UTSW 18 53536741 critical splice donor site probably null
R6113:Prdm6 UTSW 18 53473601 missense probably damaging 1.00
R6701:Prdm6 UTSW 18 53536679 missense possibly damaging 0.93
R6747:Prdm6 UTSW 18 53465046 unclassified probably benign
R6784:Prdm6 UTSW 18 53536626 missense probably benign 0.04
R7363:Prdm6 UTSW 18 53465127 missense possibly damaging 0.75
R8365:Prdm6 UTSW 18 53552065 missense probably benign 0.22
R8469:Prdm6 UTSW 18 53464686 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AATGCTTGCCTGTGAGTCGC -3'
(R):5'- CCAAAGGTGTACAACTGGCC -3'

Sequencing Primer
(F):5'- TGTTCCTGCGACAACAAGTAG -3'
(R):5'- GGTGTACAACTGGCCAGTACTTAC -3'
Posted On2021-07-15