Incidental Mutation 'R0729:Ddx31'
ID 67360
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene Name DEAD/H box helicase 31
Synonyms 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
MMRRC Submission 038910-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.879) question?
Stock # R0729 (G1)
Quality Score 207
Status Validated
Chromosome 2
Chromosomal Location 28730418-28795583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28764186 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 464 (I464T)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
AlphaFold Q6NZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: I464T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: I464T

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Meta Mutation Damage Score 0.8683 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,050,281 (GRCm39) A828S probably benign Het
Acsm3 T C 7: 119,383,207 (GRCm39) probably benign Het
Adamts12 G A 15: 11,255,769 (GRCm39) R446H possibly damaging Het
Adgrb1 A G 15: 74,420,398 (GRCm39) N849S probably damaging Het
Ankra2 A G 13: 98,408,235 (GRCm39) D228G probably damaging Het
Bicd1 T C 6: 149,414,412 (GRCm39) V375A probably damaging Het
Blvrb A G 7: 27,147,555 (GRCm39) K5E possibly damaging Het
Cacna2d2 A G 9: 107,394,456 (GRCm39) N573D probably benign Het
Calhm2 C A 19: 47,121,356 (GRCm39) G271V possibly damaging Het
Capn13 C T 17: 73,629,064 (GRCm39) G581E probably damaging Het
Capzb T C 4: 139,016,288 (GRCm39) probably benign Het
Casd1 T C 6: 4,619,753 (GRCm39) probably benign Het
Clca4b A G 3: 144,634,111 (GRCm39) probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Crx A G 7: 15,605,058 (GRCm39) probably benign Het
Cyp2c68 T C 19: 39,727,994 (GRCm39) probably benign Het
Dcaf8 T A 1: 172,000,221 (GRCm39) D126E probably benign Het
Dhx32 G A 7: 133,339,150 (GRCm39) T155I probably benign Het
Elac2 C A 11: 64,889,349 (GRCm39) P567T possibly damaging Het
Fat4 A G 3: 39,054,444 (GRCm39) probably benign Het
Fh1 T G 1: 175,442,383 (GRCm39) N156H probably damaging Het
Gm10064 T C 5: 122,835,584 (GRCm39) noncoding transcript Het
Gm14137 A G 2: 119,005,834 (GRCm39) E131G probably benign Het
Gpr22 T A 12: 31,759,312 (GRCm39) K233M probably damaging Het
Gpr63 A G 4: 25,007,480 (GRCm39) N68S probably benign Het
Gypa C T 8: 81,223,421 (GRCm39) P66S unknown Het
Htr2a A T 14: 74,879,587 (GRCm39) Q72L probably benign Het
Klhdc7b C T 15: 89,271,598 (GRCm39) R827* probably null Het
Leo1 G A 9: 75,364,420 (GRCm39) R520Q possibly damaging Het
Lrrc66 T C 5: 73,765,757 (GRCm39) M429V probably benign Het
Lrrc74a C T 12: 86,792,353 (GRCm39) Q225* probably null Het
Mamdc4 T A 2: 25,460,048 (GRCm39) N68Y probably damaging Het
Map3k10 G A 7: 27,360,992 (GRCm39) P507L probably damaging Het
Methig1 T A 15: 100,272,870 (GRCm39) C68S probably benign Het
Metrn C T 17: 26,015,202 (GRCm39) probably benign Het
Mmp12 C T 9: 7,358,290 (GRCm39) T392I possibly damaging Het
Mss51 A T 14: 20,533,160 (GRCm39) I437N probably damaging Het
Mtus2 A G 5: 148,014,097 (GRCm39) T297A probably benign Het
Myo10 T C 15: 25,722,243 (GRCm39) probably benign Het
Ncoa7 G A 10: 30,567,575 (GRCm39) P319S probably benign Het
Nlrp4d A T 7: 10,111,612 (GRCm39) probably benign Het
Obscn A G 11: 58,923,535 (GRCm39) S6455P probably damaging Het
Or5b97 T C 19: 12,878,259 (GRCm39) N295S probably damaging Het
Or8b37 G T 9: 37,959,123 (GRCm39) V202L probably benign Het
Pcdh12 A G 18: 38,415,517 (GRCm39) I536T probably benign Het
Pex5l G T 3: 33,008,685 (GRCm39) probably benign Het
Pla2g2e A C 4: 138,608,046 (GRCm39) K43Q possibly damaging Het
Rasa4 T C 5: 136,130,924 (GRCm39) probably benign Het
Rsf1 C T 7: 97,328,234 (GRCm39) R1079W probably damaging Het
Sez6 A G 11: 77,867,411 (GRCm39) T803A probably benign Het
Shcbp1 T A 8: 4,786,297 (GRCm39) N602Y probably benign Het
Slc16a13 G A 11: 70,109,857 (GRCm39) P215S probably damaging Het
Slc39a6 T C 18: 24,734,527 (GRCm39) Q54R probably benign Het
Smg1 C A 7: 117,745,512 (GRCm39) probably benign Het
Spg7 A G 8: 123,797,156 (GRCm39) N110D probably damaging Het
Sptbn1 A T 11: 30,060,902 (GRCm39) S2010T probably damaging Het
Sun1 T A 5: 139,223,619 (GRCm39) probably benign Het
Sytl5 A G X: 9,860,736 (GRCm39) E717G probably damaging Het
Tle1 A T 4: 72,044,679 (GRCm39) probably benign Het
Tm9sf4 T A 2: 153,033,065 (GRCm39) V290E probably damaging Het
Tmem63b A G 17: 45,985,060 (GRCm39) S179P probably damaging Het
Trpm3 T A 19: 22,965,153 (GRCm39) F1549L probably benign Het
Ubr4 A T 4: 139,212,631 (GRCm39) Y5063F possibly damaging Het
Uroc1 T A 6: 90,313,937 (GRCm39) Y75N probably damaging Het
Vmn2r70 T C 7: 85,215,112 (GRCm39) T141A probably benign Het
Vps13c A G 9: 67,868,931 (GRCm39) K3128E probably damaging Het
Wdr26 T C 1: 181,013,470 (GRCm39) probably null Het
Wrn T A 8: 33,738,946 (GRCm39) probably null Het
Zfp106 C T 2: 120,385,729 (GRCm39) V13M probably damaging Het
Zfp456 G A 13: 67,514,663 (GRCm39) H348Y probably damaging Het
Zfpm1 G A 8: 123,063,398 (GRCm39) R819H probably benign Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28,765,847 (GRCm39) splice site probably benign
IGL01918:Ddx31 APN 2 28,764,176 (GRCm39) missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28,749,041 (GRCm39) missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28,765,838 (GRCm39) missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28,749,035 (GRCm39) missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28,747,144 (GRCm39) missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28,748,789 (GRCm39) missense probably null 1.00
R1227:Ddx31 UTSW 2 28,747,187 (GRCm39) missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28,771,171 (GRCm39) missense probably benign 0.00
R1608:Ddx31 UTSW 2 28,749,078 (GRCm39) missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28,782,532 (GRCm39) missense probably benign
R1674:Ddx31 UTSW 2 28,748,828 (GRCm39) missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28,782,465 (GRCm39) missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28,749,002 (GRCm39) missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28,748,864 (GRCm39) missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28,794,696 (GRCm39) missense probably benign 0.00
R4972:Ddx31 UTSW 2 28,750,782 (GRCm39) missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28,736,042 (GRCm39) missense probably benign 0.03
R5358:Ddx31 UTSW 2 28,753,782 (GRCm39) missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28,776,981 (GRCm39) missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28,749,902 (GRCm39) missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28,764,185 (GRCm39) missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28,734,854 (GRCm39) missense probably benign 0.00
R6245:Ddx31 UTSW 2 28,734,994 (GRCm39) missense probably benign 0.00
R6463:Ddx31 UTSW 2 28,737,525 (GRCm39) critical splice donor site probably null
R6647:Ddx31 UTSW 2 28,765,750 (GRCm39) missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28,764,188 (GRCm39) missense probably benign 0.26
R6917:Ddx31 UTSW 2 28,782,421 (GRCm39) missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28,738,318 (GRCm39) missense probably benign
R7819:Ddx31 UTSW 2 28,782,463 (GRCm39) missense probably damaging 1.00
R8812:Ddx31 UTSW 2 28,730,816 (GRCm39) unclassified probably benign
R9122:Ddx31 UTSW 2 28,748,753 (GRCm39) missense probably damaging 1.00
R9326:Ddx31 UTSW 2 28,749,008 (GRCm39) missense probably damaging 1.00
R9571:Ddx31 UTSW 2 28,750,034 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGCCAGGAGTAGTAACACACATTG -3'
(R):5'- AGCTGAGCCATTTCCTTCTGAACAC -3'

Sequencing Primer
(F):5'- agaccaaggcaggaaaattcaag -3'
(R):5'- GAACTATGCCCTCTCCTGAGAATG -3'
Posted On 2013-09-03