Incidental Mutation 'R0729:Ddx31'
ID67360
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Synonyms
MMRRC Submission 038910-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R0729 (G1)
Quality Score207
Status Validated
Chromosome2
Chromosomal Location28840406-28905571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28874174 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 464 (I464T)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: I464T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: I464T

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Meta Mutation Damage Score 0.8683 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,159,455 A828S probably benign Het
Acsm3 T C 7: 119,783,984 probably benign Het
Adamts12 G A 15: 11,255,683 R446H possibly damaging Het
Adgrb1 A G 15: 74,548,549 N849S probably damaging Het
Ankra2 A G 13: 98,271,727 D228G probably damaging Het
Bicd1 T C 6: 149,512,914 V375A probably damaging Het
Blvrb A G 7: 27,448,130 K5E possibly damaging Het
Cacna2d2 A G 9: 107,517,257 N573D probably benign Het
Calhm2 C A 19: 47,132,917 G271V possibly damaging Het
Capn13 C T 17: 73,322,069 G581E probably damaging Het
Capzb T C 4: 139,288,977 probably benign Het
Casd1 T C 6: 4,619,753 probably benign Het
Clca4b A G 3: 144,928,350 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crx A G 7: 15,871,133 probably benign Het
Cyp2c68 T C 19: 39,739,550 probably benign Het
Dcaf8 T A 1: 172,172,654 D126E probably benign Het
Dhx32 G A 7: 133,737,421 T155I probably benign Het
Elac2 C A 11: 64,998,523 P567T possibly damaging Het
Fat4 A G 3: 39,000,295 probably benign Het
Fh1 T G 1: 175,614,817 N156H probably damaging Het
Gm10064 T C 5: 122,697,521 noncoding transcript Het
Gm14137 A G 2: 119,175,353 E131G probably benign Het
Gpr22 T A 12: 31,709,313 K233M probably damaging Het
Gpr63 A G 4: 25,007,480 N68S probably benign Het
Gypa C T 8: 80,496,792 P66S unknown Het
Htr2a A T 14: 74,642,147 Q72L probably benign Het
Klhdc7b C T 15: 89,387,395 R827* probably null Het
Leo1 G A 9: 75,457,138 R520Q possibly damaging Het
Lrrc66 T C 5: 73,608,414 M429V probably benign Het
Lrrc74a C T 12: 86,745,579 Q225* probably null Het
Mamdc4 T A 2: 25,570,036 N68Y probably damaging Het
Map3k10 G A 7: 27,661,567 P507L probably damaging Het
Methig1 T A 15: 100,374,989 C68S probably benign Het
Metrn C T 17: 25,796,228 probably benign Het
Mmp12 C T 9: 7,358,290 T392I possibly damaging Het
Mss51 A T 14: 20,483,092 I437N probably damaging Het
Mtus2 A G 5: 148,077,287 T297A probably benign Het
Myo10 T C 15: 25,722,157 probably benign Het
Ncoa7 G A 10: 30,691,579 P319S probably benign Het
Nlrp4d A T 7: 10,377,685 probably benign Het
Obscn A G 11: 59,032,709 S6455P probably damaging Het
Olfr1447 T C 19: 12,900,895 N295S probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Pcdh12 A G 18: 38,282,464 I536T probably benign Het
Pex5l G T 3: 32,954,536 probably benign Het
Pla2g2e A C 4: 138,880,735 K43Q possibly damaging Het
Rasa4 T C 5: 136,102,070 probably benign Het
Rsf1 C T 7: 97,679,027 R1079W probably damaging Het
Sez6 A G 11: 77,976,585 T803A probably benign Het
Shcbp1 T A 8: 4,736,297 N602Y probably benign Het
Slc16a13 G A 11: 70,219,031 P215S probably damaging Het
Slc39a6 T C 18: 24,601,470 Q54R probably benign Het
Smg1 C A 7: 118,146,289 probably benign Het
Spg7 A G 8: 123,070,417 N110D probably damaging Het
Sptbn1 A T 11: 30,110,902 S2010T probably damaging Het
Sun1 T A 5: 139,237,864 probably benign Het
Sytl5 A G X: 9,994,497 E717G probably damaging Het
Tle1 A T 4: 72,126,442 probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Tmem63b A G 17: 45,674,134 S179P probably damaging Het
Trpm3 T A 19: 22,987,789 F1549L probably benign Het
Ubr4 A T 4: 139,485,320 Y5063F possibly damaging Het
Uroc1 T A 6: 90,336,955 Y75N probably damaging Het
Vmn2r70 T C 7: 85,565,904 T141A probably benign Het
Vps13c A G 9: 67,961,649 K3128E probably damaging Het
Wdr26 T C 1: 181,185,905 probably null Het
Wrn T A 8: 33,248,918 probably null Het
Zfp106 C T 2: 120,555,248 V13M probably damaging Het
Zfp456 G A 13: 67,366,544 H348Y probably damaging Het
Zfpm1 G A 8: 122,336,659 R819H probably benign Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28875835 splice site probably benign
IGL01918:Ddx31 APN 2 28874164 missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28859029 missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28875826 missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28859023 missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28857132 missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28858777 missense probably null 1.00
R1227:Ddx31 UTSW 2 28857175 missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28881159 missense probably benign 0.00
R1608:Ddx31 UTSW 2 28859066 missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28892520 missense probably benign
R1674:Ddx31 UTSW 2 28858816 missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28892453 missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28858990 missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28858852 missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28904684 missense probably benign 0.00
R4972:Ddx31 UTSW 2 28860770 missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28846030 missense probably benign 0.03
R5358:Ddx31 UTSW 2 28863770 missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28886969 missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28859890 missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28874173 missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28844842 missense probably benign 0.00
R6245:Ddx31 UTSW 2 28844982 missense probably benign 0.00
R6463:Ddx31 UTSW 2 28847513 critical splice donor site probably null
R6647:Ddx31 UTSW 2 28875738 missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28874176 missense probably benign 0.26
R6917:Ddx31 UTSW 2 28892409 missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28848306 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGCCAGGAGTAGTAACACACATTG -3'
(R):5'- AGCTGAGCCATTTCCTTCTGAACAC -3'

Sequencing Primer
(F):5'- agaccaaggcaggaaaattcaag -3'
(R):5'- GAACTATGCCCTCTCCTGAGAATG -3'
Posted On2013-09-03