Incidental Mutation 'R8828:Lrguk'
ID 673603
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R8828 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 34029448-34134034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 34103637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 1269 (Q1269P)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000228187
AA Change: Q1269P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C T 9: 105,144,449 D133N probably damaging Het
Abi3bp A T 16: 56,687,092 Y1091F probably damaging Het
Arl8b A G 6: 108,815,289 I104V probably benign Het
Asb2 C A 12: 103,338,198 G16C probably benign Het
Bptf T C 11: 107,055,010 S2468G probably damaging Het
Capns1 T A 7: 30,190,538 D182V probably damaging Het
Cct5 T C 15: 31,594,512 H182R possibly damaging Het
Cd200 G A 16: 45,394,794 R165C probably benign Het
Chd3 C T 11: 69,356,271 V1024I probably damaging Het
Chd8 CAGGGTCTGCCCTCATGGTATTGTATTTCTCATAGCCTAAAAGAACAAGGG C 14: 52,210,580 probably null Het
Csmd1 T C 8: 15,998,794 S2303G probably benign Het
Ctsl A G 13: 64,366,500 S255P probably damaging Het
Dclre1c T G 2: 3,443,677 N268K possibly damaging Het
Dock10 T C 1: 80,543,417 D1158G probably damaging Het
Dock6 A T 9: 21,846,501 D102E probably benign Het
Dvl3 T A 16: 20,525,745 D290E probably damaging Het
Fam72a T A 1: 131,530,723 C74* probably null Het
Gnrh1 T A 14: 67,747,885 L73Q probably damaging Het
Grina T A 15: 76,248,297 S115T probably damaging Het
Grm3 A T 5: 9,504,725 S856T probably benign Het
Hars C A 18: 36,766,943 R490L possibly damaging Het
Ide T A 19: 37,314,842 K318I Het
Immt C A 6: 71,852,778 S156* probably null Het
Iqcd A G 5: 120,600,167 I17V possibly damaging Het
Klhdc1 T C 12: 69,252,034 V131A probably damaging Het
Klk6 C A 7: 43,828,637 N144K Het
Klk6 T C 7: 43,828,638 C145R probably damaging Het
Lrfn2 A T 17: 49,097,104 T752S probably damaging Het
Lrwd1 G T 5: 136,135,933 Q7K probably benign Het
Macf1 A T 4: 123,408,411 M766K probably benign Het
Myo3a A T 2: 22,241,053 T4S probably benign Het
Neb T C 2: 52,194,426 Y5587C probably damaging Het
Nf1 A T 11: 79,395,853 probably null Het
Npepps G T 11: 97,240,997 R344S probably damaging Het
Olfr111 A G 17: 37,530,442 N155S probably damaging Het
Olfr656 A T 7: 104,618,279 Y200F probably damaging Het
Pcnx T A 12: 81,995,823 W2286R probably damaging Het
Ppm1g A T 5: 31,208,424 N51K probably benign Het
Ppp1r13b T C 12: 111,833,547 K722E probably damaging Het
Prim1 A G 10: 128,023,892 S318G probably damaging Het
Prl4a1 T C 13: 28,023,324 Y194H probably damaging Het
Prl7c1 A T 13: 27,773,871 D195E probably benign Het
Psmb2 A G 4: 126,709,537 D186G probably benign Het
Ptprq A G 10: 107,646,652 V1020A probably benign Het
Scgb2b20 T C 7: 33,366,264 T13A unknown Het
Scly C A 1: 91,317,108 H310Q possibly damaging Het
Sdccag8 G A 1: 176,955,907 E661K probably damaging Het
Sema4f G A 6: 82,917,892 L441F probably benign Het
Sema4f A C 6: 82,917,893 Y440* probably null Het
Tmem262 C T 19: 6,080,088 probably benign Het
Trim33 A G 3: 103,329,076 T501A probably damaging Het
Trio C A 15: 27,741,064 V2692F possibly damaging Het
Ttn G T 2: 76,711,612 R33677S probably benign Het
Ttn A T 2: 76,942,430 V2453E unknown Het
Uaca T A 9: 60,871,570 S1080T probably benign Het
Vav3 T A 3: 109,647,735 C660S probably benign Het
Vmn1r229 T A 17: 20,814,728 D78E probably damaging Het
Vmn2r73 A G 7: 85,871,971 V263A probably damaging Het
Yeats2 A T 16: 20,150,510 D17V probably benign Het
Zfp658 T A 7: 43,572,816 W172R probably benign Het
Zfp804a A C 2: 82,259,115 H1096P possibly damaging Het
Zkscan14 C T 5: 145,201,565 W37* probably null Het
Zmynd15 A T 11: 70,464,191 D468V probably damaging Het
Zmynd8 A T 2: 165,812,546 V682E probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
R8551:Lrguk UTSW 6 34116511 missense probably damaging 0.96
R8879:Lrguk UTSW 6 34029683 missense probably benign 0.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGAGGATCAGCCAACCAGAG -3'
(R):5'- AAGGCTCACACTTTGATACTCTG -3'

Sequencing Primer
(F):5'- TCAGCCAACCAGAGAGGGTC -3'
(R):5'- GATACTCTGACTGCCCCTGG -3'
Posted On 2021-07-15