Incidental Mutation 'R8828:Lrguk'
ID 673603
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 068730-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8828 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 34080572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 1269 (Q1269P)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000228187
AA Change: Q1269P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A T 16: 56,507,455 (GRCm39) Y1091F probably damaging Het
Arl8b A G 6: 108,792,250 (GRCm39) I104V probably benign Het
Asb2 C A 12: 103,304,457 (GRCm39) G16C probably benign Het
Bptf T C 11: 106,945,836 (GRCm39) S2468G probably damaging Het
Capns1 T A 7: 29,889,963 (GRCm39) D182V probably damaging Het
Cct5 T C 15: 31,594,658 (GRCm39) H182R possibly damaging Het
Cd200 G A 16: 45,215,157 (GRCm39) R165C probably benign Het
Chd3 C T 11: 69,247,097 (GRCm39) V1024I probably damaging Het
Chd8 CAGGGTCTGCCCTCATGGTATTGTATTTCTCATAGCCTAAAAGAACAAGGG C 14: 52,448,037 (GRCm39) probably null Het
Csmd1 T C 8: 16,048,794 (GRCm39) S2303G probably benign Het
Ctsl A G 13: 64,514,314 (GRCm39) S255P probably damaging Het
Dclre1c T G 2: 3,444,714 (GRCm39) N268K possibly damaging Het
Dock10 T C 1: 80,521,134 (GRCm39) D1158G probably damaging Het
Dock6 A T 9: 21,757,797 (GRCm39) D102E probably benign Het
Dvl3 T A 16: 20,344,495 (GRCm39) D290E probably damaging Het
Fam72a T A 1: 131,458,461 (GRCm39) C74* probably null Het
Gnrh1 T A 14: 67,985,334 (GRCm39) L73Q probably damaging Het
Grina T A 15: 76,132,497 (GRCm39) S115T probably damaging Het
Grm3 A T 5: 9,554,725 (GRCm39) S856T probably benign Het
Hars1 C A 18: 36,899,996 (GRCm39) R490L possibly damaging Het
Ide T A 19: 37,292,241 (GRCm39) K318I Het
Immt C A 6: 71,829,762 (GRCm39) S156* probably null Het
Iqcd A G 5: 120,738,232 (GRCm39) I17V possibly damaging Het
Klhdc1 T C 12: 69,298,808 (GRCm39) V131A probably damaging Het
Klk6 C A 7: 43,478,061 (GRCm39) N144K Het
Klk6 T C 7: 43,478,062 (GRCm39) C145R probably damaging Het
Lrfn2 A T 17: 49,404,132 (GRCm39) T752S probably damaging Het
Lrwd1 G T 5: 136,164,787 (GRCm39) Q7K probably benign Het
Macf1 A T 4: 123,302,204 (GRCm39) M766K probably benign Het
Myo3a A T 2: 22,245,864 (GRCm39) T4S probably benign Het
Neb T C 2: 52,084,438 (GRCm39) Y5587C probably damaging Het
Nf1 A T 11: 79,286,679 (GRCm39) probably null Het
Npepps G T 11: 97,131,823 (GRCm39) R344S probably damaging Het
Nudt16l2 C T 9: 105,021,648 (GRCm39) D133N probably damaging Het
Or52p1 A T 7: 104,267,486 (GRCm39) Y200F probably damaging Het
Or5v1b A G 17: 37,841,333 (GRCm39) N155S probably damaging Het
Pcnx1 T A 12: 82,042,597 (GRCm39) W2286R probably damaging Het
Ppm1g A T 5: 31,365,768 (GRCm39) N51K probably benign Het
Ppp1r13b T C 12: 111,799,981 (GRCm39) K722E probably damaging Het
Prim1 A G 10: 127,859,761 (GRCm39) S318G probably damaging Het
Prl4a1 T C 13: 28,207,307 (GRCm39) Y194H probably damaging Het
Prl7c1 A T 13: 27,957,854 (GRCm39) D195E probably benign Het
Psmb2 A G 4: 126,603,330 (GRCm39) D186G probably benign Het
Ptprq A G 10: 107,482,513 (GRCm39) V1020A probably benign Het
Scgb2b20 T C 7: 33,065,689 (GRCm39) T13A unknown Het
Scly C A 1: 91,244,830 (GRCm39) H310Q possibly damaging Het
Sdccag8 G A 1: 176,783,473 (GRCm39) E661K probably damaging Het
Sema4f G A 6: 82,894,873 (GRCm39) L441F probably benign Het
Sema4f A C 6: 82,894,874 (GRCm39) Y440* probably null Het
Tmem262 C T 19: 6,130,118 (GRCm39) probably benign Het
Trim33 A G 3: 103,236,392 (GRCm39) T501A probably damaging Het
Trio C A 15: 27,741,150 (GRCm39) V2692F possibly damaging Het
Ttn A T 2: 76,772,774 (GRCm39) V2453E unknown Het
Ttn G T 2: 76,541,956 (GRCm39) R33677S probably benign Het
Uaca T A 9: 60,778,852 (GRCm39) S1080T probably benign Het
Vav3 T A 3: 109,555,051 (GRCm39) C660S probably benign Het
Vmn1r229 T A 17: 21,034,990 (GRCm39) D78E probably damaging Het
Vmn2r73 A G 7: 85,521,179 (GRCm39) V263A probably damaging Het
Yeats2 A T 16: 19,969,260 (GRCm39) D17V probably benign Het
Zfp658 T A 7: 43,222,240 (GRCm39) W172R probably benign Het
Zfp804a A C 2: 82,089,459 (GRCm39) H1096P possibly damaging Het
Zkscan14 C T 5: 145,138,375 (GRCm39) W37* probably null Het
Zmynd15 A T 11: 70,355,017 (GRCm39) D468V probably damaging Het
Zmynd8 A T 2: 165,654,466 (GRCm39) V682E probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGAGGATCAGCCAACCAGAG -3'
(R):5'- AAGGCTCACACTTTGATACTCTG -3'

Sequencing Primer
(F):5'- TCAGCCAACCAGAGAGGGTC -3'
(R):5'- GATACTCTGACTGCCCCTGG -3'
Posted On 2021-07-15