Incidental Mutation 'R8829:Kit'
ID673672
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R8829 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75639131 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 508 (N508D)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
PDB Structure Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: N508D

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: N508D

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144270
AA Change: N508D

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: N508D

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
Aadac A T 3: 60,031,819 I5F probably benign Het
Abca13 A T 11: 9,621,881 D4814V probably damaging Het
Adgrl1 A G 8: 83,938,829 N1382D Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Bach2 A T 4: 32,562,028 E165V probably damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Ccpg1 A T 9: 73,010,351 D255V probably benign Het
Cdhr2 A T 13: 54,718,117 Y278F probably damaging Het
Cdk17 C T 10: 93,207,058 probably benign Het
Celsr3 A G 9: 108,840,383 D2216G probably benign Het
Cenpu T C 8: 46,573,461 L294P probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Ctnna2 G A 6: 77,605,222 R352* probably null Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
D630003M21Rik C A 2: 158,216,936 C348F probably damaging Het
Dcdc2a C T 13: 25,110,068 Q236* probably null Het
Ddx60 T G 8: 61,940,661 S44A probably damaging Het
Dennd2c T A 3: 103,152,404 probably null Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Frem1 T C 4: 83,000,194 R504G probably damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm34653 T A 2: 34,838,622 N144K probably benign Het
Gprc6a A C 10: 51,615,199 I818R probably damaging Het
Hcfc2 T C 10: 82,738,345 Y118H probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Htr1d A T 4: 136,443,243 H261L probably benign Het
Igf1r T A 7: 68,226,021 F1244I probably damaging Het
Ighv1-63 A G 12: 115,495,914 V21A probably benign Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Knstrn C T 2: 118,823,741 Q211* probably null Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mgat4c A T 10: 102,378,223 K22N probably damaging Het
Mpo T A 11: 87,803,424 F660Y probably damaging Het
Myb A T 10: 21,145,231 L433H probably damaging Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Ncoa3 A G 2: 166,050,148 Y148C probably damaging Het
Nktr T A 9: 121,754,264 S1432T unknown Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr930 G T 9: 38,930,894 C241F probably damaging Het
Olfr986 T A 9: 40,187,913 F266Y probably benign Het
Pclo T C 5: 14,788,450 W1424R Het
Pcx A G 19: 4,601,940 D72G probably damaging Het
Pebp4 A G 14: 70,048,467 D193G probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Piezo1 A C 8: 122,491,014 M1265R Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptger3 A G 3: 157,567,786 T257A probably damaging Het
Relt T A 7: 100,850,272 S147C probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Scn9a T A 2: 66,483,617 D1919V probably benign Het
Sept8 G A 11: 53,532,038 V25I probably damaging Het
Serpinb2 A G 1: 107,515,527 I19V probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Syne1 T C 10: 5,108,685 E7276G probably benign Het
Syt1 C A 10: 108,642,332 C77F probably benign Het
Tcf20 T A 15: 82,855,714 K512M probably damaging Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trank1 T C 9: 111,347,523 S288P probably benign Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Ttbk1 C A 17: 46,446,895 G938W probably damaging Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zpr1 T A 9: 46,281,046 Y418* probably null Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
casper UTSW 5 75645875 missense probably damaging 1.00
Mooyah2 UTSW 5 75652808 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
slimmer UTSW 5 75640757 missense possibly damaging 0.94
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
R7021:Kit UTSW 5 75620967 missense probably benign 0.00
R7080:Kit UTSW 5 75607281 missense probably damaging 0.99
R7117:Kit UTSW 5 75607098 missense probably benign 0.18
R7156:Kit UTSW 5 75615374 missense probably benign 0.14
R7379:Kit UTSW 5 75647752 missense probably damaging 1.00
R7427:Kit UTSW 5 75645847 missense possibly damaging 0.92
R7438:Kit UTSW 5 75639000 missense probably benign 0.01
R7531:Kit UTSW 5 75607040 missense probably damaging 0.99
R7711:Kit UTSW 5 75637359 missense probably damaging 0.97
R7810:Kit UTSW 5 75609322 missense probably benign 0.11
R7819:Kit UTSW 5 75645932 missense probably benign 0.41
R8021:Kit UTSW 5 75615491 missense possibly damaging 0.79
R8139:Kit UTSW 5 75652805 missense probably damaging 0.99
R8165:Kit UTSW 5 75620880 missense possibly damaging 0.94
R8249:Kit UTSW 5 75641408 missense probably damaging 0.97
R8288:Kit UTSW 5 75654489 missense probably damaging 1.00
R8290:Kit UTSW 5 75641169 missense probably benign
R8832:Kit UTSW 5 75639131 missense probably benign 0.41
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGCAGGCTTCTATTTGGC -3'
(R):5'- CATCAGCAGACTAGTATGGGATGAG -3'

Sequencing Primer
(F):5'- GCAGGCTTCTATTTGGCTTACC -3'
(R):5'- AGACTAGTATGGGATGAGTTTGTGAC -3'
Posted On2021-07-15