Incidental Mutation 'R8829:Igf1r'
ID673678
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8829 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68226021 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1244 (F1244I)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect probably damaging
Transcript: ENSMUST00000005671
AA Change: F1244I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: F1244I

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
Aadac A T 3: 60,031,819 I5F probably benign Het
Abca13 A T 11: 9,621,881 D4814V probably damaging Het
Adgrl1 A G 8: 83,938,829 N1382D Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Bach2 A T 4: 32,562,028 E165V probably damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Ccpg1 A T 9: 73,010,351 D255V probably benign Het
Cdhr2 A T 13: 54,718,117 Y278F probably damaging Het
Cdk17 C T 10: 93,207,058 probably benign Het
Celsr3 A G 9: 108,840,383 D2216G probably benign Het
Cenpu T C 8: 46,573,461 L294P probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Ctnna2 G A 6: 77,605,222 R352* probably null Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
D630003M21Rik C A 2: 158,216,936 C348F probably damaging Het
Dcdc2a C T 13: 25,110,068 Q236* probably null Het
Ddx60 T G 8: 61,940,661 S44A probably damaging Het
Dennd2c T A 3: 103,152,404 probably null Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Frem1 T C 4: 83,000,194 R504G probably damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm34653 T A 2: 34,838,622 N144K probably benign Het
Gprc6a A C 10: 51,615,199 I818R probably damaging Het
Hcfc2 T C 10: 82,738,345 Y118H probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Htr1d A T 4: 136,443,243 H261L probably benign Het
Ighv1-63 A G 12: 115,495,914 V21A probably benign Het
Kit A G 5: 75,639,131 N508D probably benign Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Knstrn C T 2: 118,823,741 Q211* probably null Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mgat4c A T 10: 102,378,223 K22N probably damaging Het
Mpo T A 11: 87,803,424 F660Y probably damaging Het
Myb A T 10: 21,145,231 L433H probably damaging Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Ncoa3 A G 2: 166,050,148 Y148C probably damaging Het
Nktr T A 9: 121,754,264 S1432T unknown Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr930 G T 9: 38,930,894 C241F probably damaging Het
Olfr986 T A 9: 40,187,913 F266Y probably benign Het
Pclo T C 5: 14,788,450 W1424R Het
Pcx A G 19: 4,601,940 D72G probably damaging Het
Pebp4 A G 14: 70,048,467 D193G probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Piezo1 A C 8: 122,491,014 M1265R Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptger3 A G 3: 157,567,786 T257A probably damaging Het
Relt T A 7: 100,850,272 S147C probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Scn9a T A 2: 66,483,617 D1919V probably benign Het
Sept8 G A 11: 53,532,038 V25I probably damaging Het
Serpinb2 A G 1: 107,515,527 I19V probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Syne1 T C 10: 5,108,685 E7276G probably benign Het
Syt1 C A 10: 108,642,332 C77F probably benign Het
Tcf20 T A 15: 82,855,714 K512M probably damaging Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trank1 T C 9: 111,347,523 S288P probably benign Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Ttbk1 C A 17: 46,446,895 G938W probably damaging Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zpr1 T A 9: 46,281,046 Y418* probably null Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Hungarian UTSW 7 68214997 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
R8458:Igf1r UTSW 7 68195629 missense probably benign
R8539:Igf1r UTSW 7 68003848 missense probably benign 0.06
R8704:Igf1r UTSW 7 68170054 splice site probably benign
R8746:Igf1r UTSW 7 68214997 missense probably damaging 1.00
R8832:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8859:Igf1r UTSW 7 68183463 missense possibly damaging 0.75
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Z1186:Igf1r UTSW 7 68226168 small insertion probably benign
Z1186:Igf1r UTSW 7 68226169 small insertion probably benign
Z1186:Igf1r UTSW 7 68226174 small insertion probably benign
Z1186:Igf1r UTSW 7 68226180 small insertion probably benign
Z1186:Igf1r UTSW 7 68226182 small insertion probably benign
Z1191:Igf1r UTSW 7 68226169 small insertion probably benign
Z1191:Igf1r UTSW 7 68226170 small insertion probably benign
Z1191:Igf1r UTSW 7 68226173 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGAACCAAGACTTGAAGTGAGTC -3'
(R):5'- AGTGTCTTTCAGGCAGAGGC -3'

Sequencing Primer
(F):5'- AAGTGAGTCTGGGCTTGGCAC -3'
(R):5'- GGGACGCTCTCCATGTTCTCAG -3'
Posted On2021-07-15