Incidental Mutation 'R8829:Gprc6a'
ID 673695
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8829 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51614823-51631461 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 51615199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 818 (I818R)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably damaging
Transcript: ENSMUST00000020062
AA Change: I818R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: I818R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218684
AA Change: I643R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000219286
AA Change: I747R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
Aadac A T 3: 60,031,819 I5F probably benign Het
Abca13 A T 11: 9,621,881 D4814V probably damaging Het
Adgrl1 A G 8: 83,938,829 N1382D Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Bach2 A T 4: 32,562,028 E165V probably damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Ccpg1 A T 9: 73,010,351 D255V probably benign Het
Cdhr2 A T 13: 54,718,117 Y278F probably damaging Het
Cdk17 C T 10: 93,207,058 probably benign Het
Celsr3 A G 9: 108,840,383 D2216G probably benign Het
Cenpu T C 8: 46,573,461 L294P probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Ctnna2 G A 6: 77,605,222 R352* probably null Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
D630003M21Rik C A 2: 158,216,936 C348F probably damaging Het
Dcdc2a C T 13: 25,110,068 Q236* probably null Het
Ddx60 T G 8: 61,940,661 S44A probably damaging Het
Dennd2c T A 3: 103,152,404 probably null Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Frem1 T C 4: 83,000,194 R504G probably damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm34653 T A 2: 34,838,622 N144K probably benign Het
Hcfc2 T C 10: 82,738,345 Y118H probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Htr1d A T 4: 136,443,243 H261L probably benign Het
Igf1r T A 7: 68,226,021 F1244I probably damaging Het
Ighv1-63 A G 12: 115,495,914 V21A probably benign Het
Kit A G 5: 75,639,131 N508D probably benign Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Knstrn C T 2: 118,823,741 Q211* probably null Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mgat4c A T 10: 102,378,223 K22N probably damaging Het
Mpo T A 11: 87,803,424 F660Y probably damaging Het
Myb A T 10: 21,145,231 L433H probably damaging Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Ncoa3 A G 2: 166,050,148 Y148C probably damaging Het
Nktr T A 9: 121,754,264 S1432T unknown Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr930 G T 9: 38,930,894 C241F probably damaging Het
Olfr986 T A 9: 40,187,913 F266Y probably benign Het
Pclo T C 5: 14,788,450 W1424R Het
Pcx A G 19: 4,601,940 D72G probably damaging Het
Pebp4 A G 14: 70,048,467 D193G probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Piezo1 A C 8: 122,491,014 M1265R Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptger3 A G 3: 157,567,786 T257A probably damaging Het
Relt T A 7: 100,850,272 S147C probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Scn9a T A 2: 66,483,617 D1919V probably benign Het
Sept8 G A 11: 53,532,038 V25I probably damaging Het
Serpinb2 A G 1: 107,515,527 I19V probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Syne1 T C 10: 5,108,685 E7276G probably benign Het
Syt1 C A 10: 108,642,332 C77F probably benign Het
Tcf20 T A 15: 82,855,714 K512M probably damaging Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trank1 T C 9: 111,347,523 S288P probably benign Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Ttbk1 C A 17: 46,446,895 G938W probably damaging Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zpr1 T A 9: 46,281,046 Y418* probably null Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
R9151:Gprc6a UTSW 10 51621086 missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51615410 missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51628268 missense probably benign 0.20
R9766:Gprc6a UTSW 10 51615788 missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTATCGTAGCTGGTGGAG -3'
(R):5'- TCAGCACTGGCATTTGGTAC -3'

Sequencing Primer
(F):5'- TGGTGGAGTCCAGGGAAACATG -3'
(R):5'- ATGCTGGGCTACATCACAG -3'
Posted On 2021-07-15