Incidental Mutation 'R8829:Tcf20'
ID 673716
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock # R8829 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 82808436-82987872 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82855714 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 512 (K512M)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000048966
AA Change: K512M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: K512M

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109510
AA Change: K512M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: K512M

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
Aadac A T 3: 60,031,819 I5F probably benign Het
Abca13 A T 11: 9,621,881 D4814V probably damaging Het
Adgrl1 A G 8: 83,938,829 N1382D Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Bach2 A T 4: 32,562,028 E165V probably damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Ccpg1 A T 9: 73,010,351 D255V probably benign Het
Cdhr2 A T 13: 54,718,117 Y278F probably damaging Het
Cdk17 C T 10: 93,207,058 probably benign Het
Celsr3 A G 9: 108,840,383 D2216G probably benign Het
Cenpu T C 8: 46,573,461 L294P probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Ctnna2 G A 6: 77,605,222 R352* probably null Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
D630003M21Rik C A 2: 158,216,936 C348F probably damaging Het
Dcdc2a C T 13: 25,110,068 Q236* probably null Het
Ddx60 T G 8: 61,940,661 S44A probably damaging Het
Dennd2c T A 3: 103,152,404 probably null Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Frem1 T C 4: 83,000,194 R504G probably damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm34653 T A 2: 34,838,622 N144K probably benign Het
Gprc6a A C 10: 51,615,199 I818R probably damaging Het
Hcfc2 T C 10: 82,738,345 Y118H probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Htr1d A T 4: 136,443,243 H261L probably benign Het
Igf1r T A 7: 68,226,021 F1244I probably damaging Het
Ighv1-63 A G 12: 115,495,914 V21A probably benign Het
Kit A G 5: 75,639,131 N508D probably benign Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Knstrn C T 2: 118,823,741 Q211* probably null Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mgat4c A T 10: 102,378,223 K22N probably damaging Het
Mpo T A 11: 87,803,424 F660Y probably damaging Het
Myb A T 10: 21,145,231 L433H probably damaging Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Ncoa3 A G 2: 166,050,148 Y148C probably damaging Het
Nktr T A 9: 121,754,264 S1432T unknown Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr930 G T 9: 38,930,894 C241F probably damaging Het
Olfr986 T A 9: 40,187,913 F266Y probably benign Het
Pclo T C 5: 14,788,450 W1424R Het
Pcx A G 19: 4,601,940 D72G probably damaging Het
Pebp4 A G 14: 70,048,467 D193G probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Piezo1 A C 8: 122,491,014 M1265R Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptger3 A G 3: 157,567,786 T257A probably damaging Het
Relt T A 7: 100,850,272 S147C probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Scn9a T A 2: 66,483,617 D1919V probably benign Het
Sept8 G A 11: 53,532,038 V25I probably damaging Het
Serpinb2 A G 1: 107,515,527 I19V probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Syne1 T C 10: 5,108,685 E7276G probably benign Het
Syt1 C A 10: 108,642,332 C77F probably benign Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trank1 T C 9: 111,347,523 S288P probably benign Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Ttbk1 C A 17: 46,446,895 G938W probably damaging Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zpr1 T A 9: 46,281,046 Y418* probably null Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82851584 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82854199 missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82856185 missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82851957 missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7051:Tcf20 UTSW 15 82856078 missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7486:Tcf20 UTSW 15 82853734 missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82852937 missense probably benign 0.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
R8447:Tcf20 UTSW 15 82853236 missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82855951 missense probably benign 0.07
R8728:Tcf20 UTSW 15 82854957 missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82852525 missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9268:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9294:Tcf20 UTSW 15 82852696 missense probably benign 0.11
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCGCCACACTTATAGGTG -3'
(R):5'- ACTCCATCAATGATGCCCAG -3'

Sequencing Primer
(F):5'- CCACACTTATAGGTGGTGTCAGAGC -3'
(R):5'- AGTCCTAACTCTCATGCTGCAGG -3'
Posted On 2021-07-15