Incidental Mutation 'R8829:Tcf20'
ID 673716
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms SPBP, stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik
MMRRC Submission 068731-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.692) question?
Stock # R8829 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 82692637-82872073 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82739915 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 512 (K512M)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000048966
AA Change: K512M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: K512M

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109510
AA Change: K512M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: K512M

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A T 3: 59,939,240 (GRCm39) I5F probably benign Het
Abca13 A T 11: 9,571,881 (GRCm39) D4814V probably damaging Het
Adgrl1 A G 8: 84,665,458 (GRCm39) N1382D Het
Adh6b T C 3: 138,055,463 (GRCm39) V71A probably benign Het
Aox4 A T 1: 58,294,649 (GRCm39) M953L probably benign Het
B3galt9 T A 2: 34,728,634 (GRCm39) N144K probably benign Het
Bach2 A T 4: 32,562,028 (GRCm39) E165V probably damaging Het
Bltp2 A G 11: 78,158,064 (GRCm39) K409E probably benign Het
Catsperg2 A G 7: 29,397,269 (GRCm39) V1078A probably benign Het
Ccno A G 13: 113,126,239 (GRCm39) N236S probably benign Het
Ccpg1 A T 9: 72,917,633 (GRCm39) D255V probably benign Het
Cdhr2 A T 13: 54,865,930 (GRCm39) Y278F probably damaging Het
Cdk17 C T 10: 93,042,920 (GRCm39) probably benign Het
Celsr3 A G 9: 108,717,582 (GRCm39) D2216G probably benign Het
Cenpu T C 8: 47,026,496 (GRCm39) L294P probably damaging Het
Chct1 A G 11: 85,062,037 (GRCm39) D12G probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,604,874 (GRCm39) probably benign Het
Ctnna2 G A 6: 77,582,205 (GRCm39) R352* probably null Het
D630003M21Rik C A 2: 158,058,856 (GRCm39) C348F probably damaging Het
Dcdc2a C T 13: 25,294,051 (GRCm39) Q236* probably null Het
Ddx60 T G 8: 62,393,695 (GRCm39) S44A probably damaging Het
Dennd2c T A 3: 103,059,720 (GRCm39) probably null Het
Drd5 G A 5: 38,477,078 (GRCm39) V24M probably benign Het
Dthd1 T C 5: 62,971,608 (GRCm39) S144P probably benign Het
Fcna C A 2: 25,516,145 (GRCm39) R124L possibly damaging Het
Frem1 T C 4: 82,918,431 (GRCm39) R504G probably damaging Het
Gldc C G 19: 30,078,212 (GRCm39) M928I probably benign Het
Gprc6a A C 10: 51,491,295 (GRCm39) I818R probably damaging Het
Hcfc2 T C 10: 82,574,179 (GRCm39) Y118H probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Htr1d A T 4: 136,170,554 (GRCm39) H261L probably benign Het
Hycc2 A T 1: 58,587,832 (GRCm39) I127N possibly damaging Het
Igf1r T A 7: 67,875,769 (GRCm39) F1244I probably damaging Het
Ighv1-63 A G 12: 115,459,534 (GRCm39) V21A probably benign Het
Kit A G 5: 75,799,791 (GRCm39) N508D probably benign Het
Klk1b22 A T 7: 43,764,277 (GRCm39) E68D probably benign Het
Knstrn C T 2: 118,654,222 (GRCm39) Q211* probably null Het
Krtap2-4 A T 11: 99,505,246 (GRCm39) C122S unknown Het
Map3k1 T G 13: 111,889,015 (GRCm39) H1314P possibly damaging Het
Mgat4c A T 10: 102,214,084 (GRCm39) K22N probably damaging Het
Mpo T A 11: 87,694,250 (GRCm39) F660Y probably damaging Het
Myb A T 10: 21,021,130 (GRCm39) L433H probably damaging Het
Myo1c G A 11: 75,561,072 (GRCm39) V793I probably benign Het
Nckap1l T A 15: 103,387,242 (GRCm39) S706T probably benign Het
Ncoa3 A G 2: 165,892,068 (GRCm39) Y148C probably damaging Het
Nktr T A 9: 121,583,330 (GRCm39) S1432T unknown Het
Odf2l C T 3: 144,833,820 (GRCm39) S160L probably benign Het
Or10j7 C T 1: 173,011,458 (GRCm39) R181H probably benign Het
Or56b34 T C 7: 104,937,435 (GRCm39) L45P possibly damaging Het
Or6x1 T A 9: 40,099,209 (GRCm39) F266Y probably benign Het
Or8d23 G T 9: 38,842,190 (GRCm39) C241F probably damaging Het
Pclo T C 5: 14,838,464 (GRCm39) W1424R Het
Pcx A G 19: 4,651,968 (GRCm39) D72G probably damaging Het
Pebp4 A G 14: 70,285,916 (GRCm39) D193G probably benign Het
Pi4kb C T 3: 94,900,344 (GRCm39) T326M probably damaging Het
Piezo1 A C 8: 123,217,753 (GRCm39) M1265R Het
Pip4k2c A T 10: 127,037,037 (GRCm39) H177Q probably damaging Het
Pramel48 G T 5: 95,630,939 (GRCm39) C272F possibly damaging Het
Prpf40a T C 2: 53,047,927 (GRCm39) M197V probably benign Het
Ptger3 A G 3: 157,273,423 (GRCm39) T257A probably damaging Het
Relt T A 7: 100,499,479 (GRCm39) S147C probably damaging Het
Scap A G 9: 110,209,271 (GRCm39) Y648C probably damaging Het
Scn9a T A 2: 66,313,961 (GRCm39) D1919V probably benign Het
Septin8 G A 11: 53,422,865 (GRCm39) V25I probably damaging Het
Serpinb2 A G 1: 107,443,257 (GRCm39) I19V probably benign Het
Slc16a6 A G 11: 109,345,932 (GRCm39) Y444H probably benign Het
Syne1 T C 10: 5,058,685 (GRCm39) E7276G probably benign Het
Syt1 C A 10: 108,478,193 (GRCm39) C77F probably benign Het
Tomm7 T C 5: 24,049,047 (GRCm39) K9E possibly damaging Het
Trank1 T C 9: 111,176,591 (GRCm39) S288P probably benign Het
Trem3 T C 17: 48,556,865 (GRCm39) V112A probably benign Het
Ttbk1 C A 17: 46,757,821 (GRCm39) G938W probably damaging Het
Vmn1r178 G A 7: 23,593,264 (GRCm39) C104Y probably damaging Het
Zpr1 T A 9: 46,192,344 (GRCm39) Y418* probably null Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82,739,096 (GRCm39) missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82,741,343 (GRCm39) missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82,736,957 (GRCm39) missense probably benign 0.41
IGL00576:Tcf20 APN 15 82,740,276 (GRCm39) missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82,738,101 (GRCm39) missense probably benign
IGL01670:Tcf20 APN 15 82,739,564 (GRCm39) missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82,741,361 (GRCm39) missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82,740,209 (GRCm39) missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82,737,167 (GRCm39) missense probably benign
IGL01834:Tcf20 APN 15 82,739,898 (GRCm39) missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82,739,356 (GRCm39) missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82,737,660 (GRCm39) missense probably benign 0.28
IGL02731:Tcf20 APN 15 82,737,438 (GRCm39) missense probably benign 0.00
IGL02739:Tcf20 APN 15 82,740,281 (GRCm39) missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82,736,205 (GRCm39) missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82,735,785 (GRCm39) missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82,736,501 (GRCm39) missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82,739,286 (GRCm39) missense probably benign
R0732:Tcf20 UTSW 15 82,736,504 (GRCm39) missense probably benign 0.07
R1502:Tcf20 UTSW 15 82,739,777 (GRCm39) missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82,739,693 (GRCm39) missense probably benign 0.19
R1719:Tcf20 UTSW 15 82,736,978 (GRCm39) missense probably benign 0.03
R1997:Tcf20 UTSW 15 82,741,431 (GRCm39) nonsense probably null
R2152:Tcf20 UTSW 15 82,739,803 (GRCm39) missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82,738,893 (GRCm39) missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82,735,886 (GRCm39) missense probably benign
R4049:Tcf20 UTSW 15 82,737,630 (GRCm39) missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82,739,185 (GRCm39) missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82,735,928 (GRCm39) missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82,738,400 (GRCm39) missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82,740,804 (GRCm39) missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82,740,386 (GRCm39) missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82,740,582 (GRCm39) missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82,740,156 (GRCm39) missense probably benign 0.01
R5288:Tcf20 UTSW 15 82,739,910 (GRCm39) missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82,736,158 (GRCm39) missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82,740,400 (GRCm39) missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82,737,443 (GRCm39) missense probably benign 0.05
R5897:Tcf20 UTSW 15 82,735,984 (GRCm39) nonsense probably null
R6089:Tcf20 UTSW 15 82,737,409 (GRCm39) missense probably benign 0.06
R6196:Tcf20 UTSW 15 82,736,187 (GRCm39) missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82,739,081 (GRCm39) missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82,736,861 (GRCm39) missense probably benign
R6688:Tcf20 UTSW 15 82,738,736 (GRCm39) missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82,738,883 (GRCm39) missense probably benign 0.07
R7051:Tcf20 UTSW 15 82,740,279 (GRCm39) missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82,737,690 (GRCm39) missense probably benign
R7486:Tcf20 UTSW 15 82,737,935 (GRCm39) missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82,739,477 (GRCm39) missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82,735,766 (GRCm39) missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82,740,207 (GRCm39) missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82,737,138 (GRCm39) missense probably benign 0.00
R8191:Tcf20 UTSW 15 82,737,606 (GRCm39) nonsense probably null
R8259:Tcf20 UTSW 15 82,736,474 (GRCm39) missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82,736,877 (GRCm39) missense probably benign 0.04
R8447:Tcf20 UTSW 15 82,737,437 (GRCm39) missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82,740,152 (GRCm39) missense probably benign 0.07
R8728:Tcf20 UTSW 15 82,739,158 (GRCm39) missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82,736,726 (GRCm39) missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82,740,705 (GRCm39) missense probably benign 0.00
R9268:Tcf20 UTSW 15 82,740,705 (GRCm39) missense probably benign 0.00
R9294:Tcf20 UTSW 15 82,736,897 (GRCm39) missense probably benign 0.11
R9648:Tcf20 UTSW 15 82,739,876 (GRCm39) missense probably damaging 1.00
R9675:Tcf20 UTSW 15 82,740,986 (GRCm39) missense probably damaging 1.00
R9729:Tcf20 UTSW 15 82,736,037 (GRCm39) missense probably benign 0.25
RF019:Tcf20 UTSW 15 82,735,794 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCGCCACACTTATAGGTG -3'
(R):5'- ACTCCATCAATGATGCCCAG -3'

Sequencing Primer
(F):5'- CCACACTTATAGGTGGTGTCAGAGC -3'
(R):5'- AGTCCTAACTCTCATGCTGCAGG -3'
Posted On 2021-07-15