Incidental Mutation 'R8829:Gldc'
ID673722
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8829 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 30100812 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 928 (M928I)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably benign
Transcript: ENSMUST00000025778
AA Change: M928I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: M928I

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
Aadac A T 3: 60,031,819 I5F probably benign Het
Abca13 A T 11: 9,621,881 D4814V probably damaging Het
Adgrl1 A G 8: 83,938,829 N1382D Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Bach2 A T 4: 32,562,028 E165V probably damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Ccpg1 A T 9: 73,010,351 D255V probably benign Het
Cdhr2 A T 13: 54,718,117 Y278F probably damaging Het
Cdk17 C T 10: 93,207,058 probably benign Het
Celsr3 A G 9: 108,840,383 D2216G probably benign Het
Cenpu T C 8: 46,573,461 L294P probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Ctnna2 G A 6: 77,605,222 R352* probably null Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
D630003M21Rik C A 2: 158,216,936 C348F probably damaging Het
Dcdc2a C T 13: 25,110,068 Q236* probably null Het
Ddx60 T G 8: 61,940,661 S44A probably damaging Het
Dennd2c T A 3: 103,152,404 probably null Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Frem1 T C 4: 83,000,194 R504G probably damaging Het
Gm34653 T A 2: 34,838,622 N144K probably benign Het
Gprc6a A C 10: 51,615,199 I818R probably damaging Het
Hcfc2 T C 10: 82,738,345 Y118H probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Htr1d A T 4: 136,443,243 H261L probably benign Het
Igf1r T A 7: 68,226,021 F1244I probably damaging Het
Ighv1-63 A G 12: 115,495,914 V21A probably benign Het
Kit A G 5: 75,639,131 N508D probably benign Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Knstrn C T 2: 118,823,741 Q211* probably null Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mgat4c A T 10: 102,378,223 K22N probably damaging Het
Mpo T A 11: 87,803,424 F660Y probably damaging Het
Myb A T 10: 21,145,231 L433H probably damaging Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Ncoa3 A G 2: 166,050,148 Y148C probably damaging Het
Nktr T A 9: 121,754,264 S1432T unknown Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr930 G T 9: 38,930,894 C241F probably damaging Het
Olfr986 T A 9: 40,187,913 F266Y probably benign Het
Pclo T C 5: 14,788,450 W1424R Het
Pcx A G 19: 4,601,940 D72G probably damaging Het
Pebp4 A G 14: 70,048,467 D193G probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Piezo1 A C 8: 122,491,014 M1265R Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptger3 A G 3: 157,567,786 T257A probably damaging Het
Relt T A 7: 100,850,272 S147C probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Scn9a T A 2: 66,483,617 D1919V probably benign Het
Sept8 G A 11: 53,532,038 V25I probably damaging Het
Serpinb2 A G 1: 107,515,527 I19V probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Syne1 T C 10: 5,108,685 E7276G probably benign Het
Syt1 C A 10: 108,642,332 C77F probably benign Het
Tcf20 T A 15: 82,855,714 K512M probably damaging Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trank1 T C 9: 111,347,523 S288P probably benign Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Ttbk1 C A 17: 46,446,895 G938W probably damaging Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zpr1 T A 9: 46,281,046 Y418* probably null Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
R8887:Gldc UTSW 19 30133756 missense possibly damaging 0.94
R8935:Gldc UTSW 19 30131693 missense probably benign 0.00
R8940:Gldc UTSW 19 30151484 missense probably benign
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACAGCCATTCGAGATTGAAACC -3'
(R):5'- CCTGCTACTACATAGACGTACC -3'

Sequencing Primer
(F):5'- GCCATTCGAGATTGAAACCTCTGTG -3'
(R):5'- TGCTTGTAAAAGCCATGCTAC -3'
Posted On2021-07-15