Incidental Mutation 'R8830:Erbb4'
ID673726
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8830 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68075468 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 939 (L939Q)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]
Predicted Effect probably damaging
Transcript: ENSMUST00000119142
AA Change: L939Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: L939Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: L939Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: L939Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGTAACTTAGTGGCATACTATTACCTC -3'
(R):5'- TTTGTAAAAGTGCATCGTGATACGTG -3'

Sequencing Primer
(F):5'- CAGAGAAACATTTTGCAGGTAA -3'
(R):5'- AAGTGCATCGTGATACGTGTTCATTC -3'
Posted On2021-07-15