Incidental Mutation 'R8830:Sp140'
ID 673727
Institutional Source Beutler Lab
Gene Symbol Sp140
Ensembl Gene ENSMUSG00000070031
Gene Name Sp140 nuclear body protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R8830 (G1)
Quality Score 146.467
Status Not validated
Chromosome 1
Chromosomal Location 85600378-85645037 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) TTTTTTTT to TTTTTTTTTTTTT at 85644574 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080204]
AlphaFold Q6NSQ5
Predicted Effect probably benign
Transcript: ENSMUST00000080204
SMART Domains Protein: ENSMUSP00000079095
Gene: ENSMUSG00000070031

DomainStartEndE-ValueType
Pfam:Sp100 24 121 5.1e-40 PFAM
low complexity region 213 223 N/A INTRINSIC
low complexity region 240 248 N/A INTRINSIC
SAND 256 329 4.17e-34 SMART
PHD 360 402 3.7e-8 SMART
BROMO 423 526 4.49e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161497
SMART Domains Protein: ENSMUSP00000125026
Gene: ENSMUSG00000070031

DomainStartEndE-ValueType
Pfam:SAND 1 52 1e-19 PFAM
PHD 84 126 3.7e-8 SMART
Blast:BROMO 153 176 4e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SP100 family of proteins, which are share common domains including an N-terminal homogeneously staining region domain followed by a SP100/autoimmune regulator/NucP41/P75/deformed epidermal autoregulatory factor domain, a plant homeobox zinc finger, and a bromodomain. The encoded protein is interferon-inducible and is expressed at high levels in the nuclei of leukocytes. Variants of this gene have been associated with multiple sclerosis, Crohn's disease, and chronic lymphocytic leukemia. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Sp140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Sp140 APN 1 85641822 nonsense probably null
IGL00561:Sp140 APN 1 85621672 missense probably benign 0.00
IGL00572:Sp140 APN 1 85621672 missense probably benign 0.00
IGL00591:Sp140 APN 1 85621672 missense probably benign 0.00
IGL00990:Sp140 APN 1 85626165 missense possibly damaging 0.59
IGL00990:Sp140 APN 1 85626133 missense probably benign 0.00
IGL02106:Sp140 APN 1 85643219 missense probably benign 0.01
IGL02303:Sp140 APN 1 85643009 nonsense probably null
PIT4131001:Sp140 UTSW 1 85601172 missense probably benign 0.03
PIT4131001:Sp140 UTSW 1 85610882 missense probably benign 0.03
PIT4131001:Sp140 UTSW 1 85643221 missense probably benign
PIT4142001:Sp140 UTSW 1 85601172 missense probably benign 0.03
PIT4142001:Sp140 UTSW 1 85610882 missense probably benign 0.03
PIT4142001:Sp140 UTSW 1 85643221 missense probably benign
R0378:Sp140 UTSW 1 85620051 splice site probably benign
R0815:Sp140 UTSW 1 85620051 splice site probably benign
R1320:Sp140 UTSW 1 85635608 critical splice donor site probably null
R1642:Sp140 UTSW 1 85610824 splice site probably null
R1791:Sp140 UTSW 1 85620051 splice site probably benign
R4776:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R4780:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R4839:Sp140 UTSW 1 85610808 unclassified probably benign
R5051:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R5287:Sp140 UTSW 1 85610824 splice site probably null
R5379:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R6518:Sp140 UTSW 1 85644570 critical splice acceptor site probably benign
R7125:Sp140 UTSW 1 85644569 critical splice acceptor site probably benign
R7128:Sp140 UTSW 1 85620125 missense possibly damaging 0.63
R7785:Sp140 UTSW 1 85620098 missense probably benign 0.00
R8033:Sp140 UTSW 1 85620094 missense probably benign 0.01
R8481:Sp140 UTSW 1 85641791 missense probably damaging 0.99
R8501:Sp140 UTSW 1 85641740 missense probably damaging 1.00
R8994:Sp140 UTSW 1 85621882 splice site probably null
R9053:Sp140 UTSW 1 85644569 critical splice acceptor site probably benign
R9137:Sp140 UTSW 1 85642576 missense probably damaging 0.99
R9594:Sp140 UTSW 1 85632514 missense not run
Z1191:Sp140 UTSW 1 85641803 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGATTGCTTCTTACTCCCCGTAG -3'
(R):5'- GCTGCACCTGTTTCCATATG -3'

Sequencing Primer
(F):5'- CCCCGTAGTCAAGATTCTCAG -3'
(R):5'- GCACCTGTTTCCATATGACCAAGAG -3'
Posted On 2021-07-15