Incidental Mutation 'R8830:Ss18l1'
ID 673731
Institutional Source Beutler Lab
Gene Symbol Ss18l1
Ensembl Gene ENSMUSG00000039086
Gene Name SS18, nBAF chromatin remodeling complex subunit like 1
Synonyms CREST, A230053O16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180042509-180070201 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180067338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 397 (Y397H)
Ref Sequence ENSEMBL: ENSMUSP00000041288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041126] [ENSMUST00000108901] [ENSMUST00000184862]
AlphaFold Q8BW22
Predicted Effect unknown
Transcript: ENSMUST00000041126
AA Change: Y397H
SMART Domains Protein: ENSMUSP00000041288
Gene: ENSMUSG00000039086
AA Change: Y397H

DomainStartEndE-ValueType
Pfam:SSXT 13 74 4.3e-35 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 215 238 N/A INTRINSIC
low complexity region 244 251 N/A INTRINSIC
low complexity region 311 375 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108901
SMART Domains Protein: ENSMUSP00000104529
Gene: ENSMUSG00000039069

DomainStartEndE-ValueType
Pfam:GTP1_OBG 71 222 1.5e-49 PFAM
Pfam:FeoB_N 224 384 8.3e-12 PFAM
Pfam:MMR_HSR1 225 345 3.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184862
SMART Domains Protein: ENSMUSP00000139273
Gene: ENSMUSG00000039069

DomainStartEndE-ValueType
Pfam:GTP1_OBG 71 222 2e-43 PFAM
Meta Mutation Damage Score 0.4912 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-responsive transactivator which is an essential subunit of a neuron-specific chromatin-remodeling complex. The structure of this gene is similar to that of the SS18 gene. Mutations in this gene are involved in amyotrophic lateral sclerosis (ALS). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have central nervous system and coordination defects. They grow slowly and usually die before adulthood. Those that do survive are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Ss18l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0781:Ss18l1 UTSW 2 180055854 missense possibly damaging 0.57
R0904:Ss18l1 UTSW 2 180059354 missense probably damaging 1.00
R1938:Ss18l1 UTSW 2 180063345 missense unknown
R2853:Ss18l1 UTSW 2 180058121 missense probably damaging 1.00
R3825:Ss18l1 UTSW 2 180063310 missense unknown
R4907:Ss18l1 UTSW 2 180063399 critical splice donor site probably null
R5256:Ss18l1 UTSW 2 180061942 missense unknown
R5508:Ss18l1 UTSW 2 180057653 missense probably damaging 0.96
R6216:Ss18l1 UTSW 2 180061913 missense unknown
R6218:Ss18l1 UTSW 2 180055112 missense probably benign 0.00
R7529:Ss18l1 UTSW 2 180058157 missense possibly damaging 0.80
R8192:Ss18l1 UTSW 2 180059362 missense probably damaging 0.98
R8498:Ss18l1 UTSW 2 180058175 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGCCTTCCAGGGTTCTCAC -3'
(R):5'- CATATCGCAGTCAGTGGTGC -3'

Sequencing Primer
(F):5'- TGGCTCTCCAGGGTTCTCG -3'
(R):5'- GCACACAGCATCACGCC -3'
Posted On 2021-07-15