Incidental Mutation 'R8830:Slc7a13'
ID 673736
Institutional Source Beutler Lab
Gene Symbol Slc7a13
Ensembl Gene ENSMUSG00000041052
Gene Name solute carrier family 7, (cationic amino acid transporter, y+ system) member 13
Synonyms AGT1, XAT2, AGT-1, 0610009O04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 19818725-19842218 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19819189 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 130 (S130P)
Ref Sequence ENSEMBL: ENSMUSP00000036228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035890]
AlphaFold Q91WN3
Predicted Effect probably benign
Transcript: ENSMUST00000035890
AA Change: S130P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000036228
Gene: ENSMUSG00000041052
AA Change: S130P

DomainStartEndE-ValueType
Pfam:AA_permease_2 17 440 3.3e-44 PFAM
Pfam:AA_permease 21 454 3.7e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Slc7a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Slc7a13 APN 4 19839527 missense probably benign 0.00
IGL02491:Slc7a13 APN 4 19841404 missense probably damaging 0.98
IGL02541:Slc7a13 APN 4 19839212 splice site probably benign
IGL02814:Slc7a13 APN 4 19839387 missense probably benign
R0145:Slc7a13 UTSW 4 19818782 start gained probably benign
R0305:Slc7a13 UTSW 4 19839401 missense probably benign 0.12
R0468:Slc7a13 UTSW 4 19841500 missense probably benign 0.04
R0522:Slc7a13 UTSW 4 19824010 missense probably benign 0.02
R0848:Slc7a13 UTSW 4 19818866 missense probably benign 0.00
R1240:Slc7a13 UTSW 4 19819212 missense probably damaging 1.00
R1623:Slc7a13 UTSW 4 19824031 missense possibly damaging 0.84
R1830:Slc7a13 UTSW 4 19819046 missense probably benign 0.33
R1903:Slc7a13 UTSW 4 19839254 missense probably benign 0.01
R1952:Slc7a13 UTSW 4 19841578 missense probably benign
R2229:Slc7a13 UTSW 4 19839399 missense probably benign 0.43
R2887:Slc7a13 UTSW 4 19819052 missense possibly damaging 0.69
R4175:Slc7a13 UTSW 4 19819492 missense probably null 0.99
R4233:Slc7a13 UTSW 4 19819070 missense probably damaging 0.97
R4764:Slc7a13 UTSW 4 19819390 missense probably benign 0.08
R4941:Slc7a13 UTSW 4 19841467 missense probably damaging 1.00
R5355:Slc7a13 UTSW 4 19839267 missense probably benign 0.43
R6221:Slc7a13 UTSW 4 19839305 missense probably benign 0.00
R6641:Slc7a13 UTSW 4 19839534 missense probably damaging 1.00
R7237:Slc7a13 UTSW 4 19839364 missense probably benign
R8188:Slc7a13 UTSW 4 19819082 missense probably benign 0.03
R8384:Slc7a13 UTSW 4 19823984 missense probably damaging 1.00
R8753:Slc7a13 UTSW 4 19841443 missense probably damaging 0.99
R9140:Slc7a13 UTSW 4 19819487 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCTCTGCAGAGATCGGGATAAC -3'
(R):5'- GCATCAAACGCATTCTGAAGC -3'

Sequencing Primer
(F):5'- TGCAGAGATCGGGATAACCTTCC -3'
(R):5'- CAAACGCATTCTGAAGCCTTTG -3'
Posted On 2021-07-15