Incidental Mutation 'R8830:Tesk2'
ID 673738
Institutional Source Beutler Lab
Gene Symbol Tesk2
Ensembl Gene ENSMUSG00000033985
Gene Name testis-specific kinase 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 116720948-116805956 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 116802287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 315 (R315C)
Ref Sequence ENSEMBL: ENSMUSP00000041009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030451] [ENSMUST00000045542] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459] [ENSMUST00000145468]
AlphaFold Q8VCT9
Predicted Effect probably benign
Transcript: ENSMUST00000030451
SMART Domains Protein: ENSMUSP00000030451
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 39 171 3.1e-46 PFAM
Pfam:CAF1 164 452 9.9e-40 PFAM
Pfam:zf-CCCH 297 322 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045542
AA Change: R315C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985
AA Change: R315C

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106455
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106456
AA Change: R286C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985
AA Change: R286C

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106459
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145468
SMART Domains Protein: ENSMUSP00000117019
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
Pfam:CAF1 1 184 2.2e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Tesk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Tesk2 APN 4 116771801 missense possibly damaging 0.68
IGL02051:Tesk2 APN 4 116751184 missense probably damaging 1.00
IGL02223:Tesk2 APN 4 116741825 nonsense probably null
IGL02747:Tesk2 APN 4 116802879 missense probably benign 0.31
IGL02942:Tesk2 APN 4 116771820 missense probably damaging 0.99
BB006:Tesk2 UTSW 4 116802255 missense probably benign 0.08
BB016:Tesk2 UTSW 4 116802255 missense probably benign 0.08
R1804:Tesk2 UTSW 4 116800621 unclassified probably benign
R1936:Tesk2 UTSW 4 116741824 missense probably benign 0.23
R1986:Tesk2 UTSW 4 116751193 missense probably damaging 1.00
R2414:Tesk2 UTSW 4 116801757 missense possibly damaging 0.96
R4632:Tesk2 UTSW 4 116741712 missense probably benign 0.01
R4896:Tesk2 UTSW 4 116802993 missense probably benign
R5186:Tesk2 UTSW 4 116741896 missense probably damaging 1.00
R5209:Tesk2 UTSW 4 116724698 start gained probably benign
R5278:Tesk2 UTSW 4 116805936 intron probably benign
R5769:Tesk2 UTSW 4 116802315 splice site probably null
R6199:Tesk2 UTSW 4 116792170 missense probably damaging 0.98
R6464:Tesk2 UTSW 4 116802849 missense probably damaging 1.00
R6567:Tesk2 UTSW 4 116792164 missense probably damaging 1.00
R6867:Tesk2 UTSW 4 116801798 missense probably damaging 0.99
R7028:Tesk2 UTSW 4 116802687 nonsense probably null
R7929:Tesk2 UTSW 4 116802255 missense probably benign 0.08
R8957:Tesk2 UTSW 4 116802713 missense probably benign 0.10
R9043:Tesk2 UTSW 4 116802951 missense probably benign 0.20
R9074:Tesk2 UTSW 4 116801736 missense probably damaging 1.00
R9464:Tesk2 UTSW 4 116801246 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCCTTGAGTGCTGACCAAG -3'
(R):5'- TTACTGCCCATGACCACTGC -3'

Sequencing Primer
(F):5'- GTTGGAGTCCTAATACTAGAGAAAAC -3'
(R):5'- CCATGACCACTGCCCTCC -3'
Posted On 2021-07-15