Incidental Mutation 'R8830:Hpse'
ID 673740
Institutional Source Beutler Lab
Gene Symbol Hpse
Ensembl Gene ENSMUSG00000035273
Gene Name heparanase
Synonyms Hpa
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 100679484-100719716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100695586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 240 (E240G)
Ref Sequence ENSEMBL: ENSMUSP00000044072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045617] [ENSMUST00000112908]
AlphaFold Q6YGZ1
Predicted Effect probably benign
Transcript: ENSMUST00000045617
AA Change: E240G

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044072
Gene: ENSMUSG00000035273
AA Change: E240G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 132 362 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112908
AA Change: E240G

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108529
Gene: ENSMUSG00000035273
AA Change: E240G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 144 362 1.2e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes an endoglucuronidase enzyme that plays an important role in tumor invasion and metastasis. The encoded preproprotein undergoes proteolytic processing to generate an active heterodimeric enzyme that cleaves the heparan sulfate proteoglycans associated with the cell surface and extracellular matrix. Mice lacking the encoded protein do not show any prominent pathological alterations under normal conditions but fail to develop albuminuria and renal damage in response to drug-induced diabetes. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit precocious mammry gland development, increased angiogenesis and increased neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Hpse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Hpse APN 5 100691330 missense possibly damaging 0.89
IGL00743:Hpse APN 5 100698999 missense probably benign 0.01
IGL02377:Hpse APN 5 100691333 missense probably damaging 1.00
R0082:Hpse UTSW 5 100692262 missense possibly damaging 0.93
R0194:Hpse UTSW 5 100719512 missense probably benign
R1974:Hpse UTSW 5 100692238 missense probably damaging 1.00
R2065:Hpse UTSW 5 100698931 missense probably damaging 1.00
R2152:Hpse UTSW 5 100691403 nonsense probably null
R2405:Hpse UTSW 5 100708771 missense possibly damaging 0.78
R3791:Hpse UTSW 5 100692238 missense probably damaging 1.00
R5127:Hpse UTSW 5 100719537 missense unknown
R5147:Hpse UTSW 5 100719509 missense probably benign 0.00
R5385:Hpse UTSW 5 100708724 nonsense probably null
R6446:Hpse UTSW 5 100695569 nonsense probably null
R7009:Hpse UTSW 5 100692279 missense probably benign 0.01
R7186:Hpse UTSW 5 100695529 missense probably damaging 1.00
R7681:Hpse UTSW 5 100691391 missense possibly damaging 0.94
R7964:Hpse UTSW 5 100698911 critical splice donor site probably null
R8064:Hpse UTSW 5 100688900 missense probably benign 0.00
R8183:Hpse UTSW 5 100685118 missense probably damaging 1.00
R8268:Hpse UTSW 5 100699041 missense probably damaging 1.00
R8845:Hpse UTSW 5 100711382 missense probably benign
R8932:Hpse UTSW 5 100699006 missense possibly damaging 0.84
R8998:Hpse UTSW 5 100692243 missense probably damaging 1.00
X0022:Hpse UTSW 5 100691378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAACCTGTTCCGGGACAGC -3'
(R):5'- TCACCGGCCACTTTCCTTAC -3'

Sequencing Primer
(F):5'- TCTTGAAAAACCAAGAAAGCAGG -3'
(R):5'- GCCACTTTCCTTACTTTTGATTCTAG -3'
Posted On 2021-07-15