Incidental Mutation 'R8830:Wasf3'
ID 673741
Institutional Source Beutler Lab
Gene Symbol Wasf3
Ensembl Gene ENSMUSG00000029636
Gene Name WAS protein family, member 3
Synonyms Wave3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 146384985-146473615 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 146466862 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 261 (Q261*)
Ref Sequence ENSEMBL: ENSMUSP00000016143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016143]
AlphaFold Q8VHI6
Predicted Effect probably null
Transcript: ENSMUST00000016143
AA Change: Q261*
SMART Domains Protein: ENSMUSP00000016143
Gene: ENSMUSG00000029636
AA Change: Q261*

DomainStartEndE-ValueType
PDB:3P8C|D 1 171 1e-86 PDB
low complexity region 172 184 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 395 422 N/A INTRINSIC
WH2 439 456 4.97e-5 SMART
low complexity region 484 501 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. A pseudogene of this gene have been defined on chromosome 6. Alternative splicing results in multiple transcript variants [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Wasf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wasf3 APN 5 146455651 missense probably damaging 1.00
IGL01992:Wasf3 APN 5 146455591 missense probably damaging 1.00
IGL02866:Wasf3 APN 5 146468321 missense probably benign 0.28
FR4737:Wasf3 UTSW 5 146470250 missense probably damaging 0.99
R0622:Wasf3 UTSW 5 146466792 splice site probably null
R1083:Wasf3 UTSW 5 146435372 missense probably damaging 1.00
R1214:Wasf3 UTSW 5 146470288 missense probably damaging 1.00
R1259:Wasf3 UTSW 5 146451976 missense probably damaging 1.00
R1355:Wasf3 UTSW 5 146470208 splice site probably benign
R1370:Wasf3 UTSW 5 146470208 splice site probably benign
R1727:Wasf3 UTSW 5 146466959 missense probably benign
R4837:Wasf3 UTSW 5 146460978 missense probably benign 0.16
R5080:Wasf3 UTSW 5 146461097 missense probably benign
R6046:Wasf3 UTSW 5 146470356 missense unknown
R6386:Wasf3 UTSW 5 146453417 missense possibly damaging 0.77
R7181:Wasf3 UTSW 5 146466805 missense probably benign
R7229:Wasf3 UTSW 5 146455653 missense probably damaging 1.00
R8438:Wasf3 UTSW 5 146453427 missense probably benign
R8909:Wasf3 UTSW 5 146455600 missense
R9182:Wasf3 UTSW 5 146466825 nonsense probably null
R9287:Wasf3 UTSW 5 146461047 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CTGGACTTAGCTGAACGTAAAAG -3'
(R):5'- TTACCCATAGTCGGCTGGAG -3'

Sequencing Primer
(F):5'- GAAATAAGTGTCTCTGCTCAGGTAC -3'
(R):5'- CTGGAGCCACTGACGTAGAG -3'
Posted On 2021-07-15