Incidental Mutation 'R8830:Vmn1r14'
ID 673742
Institutional Source Beutler Lab
Gene Symbol Vmn1r14
Ensembl Gene ENSMUSG00000114982
Gene Name vomeronasal 1 receptor 14
Synonyms V1rc7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 57231686-57240885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 57234032 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 198 (M198I)
Ref Sequence ENSEMBL: ENSMUSP00000135207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177435] [ENSMUST00000227209] [ENSMUST00000227574] [ENSMUST00000227768] [ENSMUST00000227884]
AlphaFold H3BJ46
Predicted Effect probably damaging
Transcript: ENSMUST00000177435
AA Change: M198I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135207
Gene: ENSMUSG00000114982
AA Change: M198I

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.9e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227209
AA Change: M154I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000227574
AA Change: M154I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000227768
AA Change: M198I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227884
AA Change: M198I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Vmn1r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1083:Vmn1r14 UTSW 6 57234199 missense probably damaging 1.00
R1533:Vmn1r14 UTSW 6 57234301 missense probably damaging 1.00
R1759:Vmn1r14 UTSW 6 57234312 missense probably benign 0.00
R3945:Vmn1r14 UTSW 6 57234269 missense probably benign 0.13
R4034:Vmn1r14 UTSW 6 57234325 missense possibly damaging 0.63
R4273:Vmn1r14 UTSW 6 57234148 missense probably damaging 1.00
R4342:Vmn1r14 UTSW 6 57233823 missense probably benign 0.09
R4451:Vmn1r14 UTSW 6 57234228 missense possibly damaging 0.86
R5978:Vmn1r14 UTSW 6 57233944 missense probably benign 0.06
R6378:Vmn1r14 UTSW 6 57233602 missense probably benign 0.09
R6829:Vmn1r14 UTSW 6 57233551 missense probably benign 0.06
R7153:Vmn1r14 UTSW 6 57233866 missense probably benign 0.10
R8015:Vmn1r14 UTSW 6 57234030 missense probably damaging 0.96
R8105:Vmn1r14 UTSW 6 57234260 missense probably benign 0.00
R8831:Vmn1r14 UTSW 6 57233520 missense probably benign 0.05
Z1177:Vmn1r14 UTSW 6 57234141 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCTGTCATGATCAGTCATAGG -3'
(R):5'- GGATGAGATGATAAAGTCCACCC -3'

Sequencing Primer
(F):5'- GCTGTCATGATCAGTCATAGGAACTC -3'
(R):5'- TGAGATGATAAAGTCCACCCAGTAC -3'
Posted On 2021-07-15