Incidental Mutation 'R8830:Ldha'
ID 673745
Institutional Source Beutler Lab
Gene Symbol Ldha
Ensembl Gene ENSMUSG00000063229
Gene Name lactate dehydrogenase A
Synonyms l7R2, Ldh-1, LDH-A, lactate dehydrogenase-A, Ldh1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 46841475-46855627 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 46850278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 144 (N144K)
Ref Sequence ENSEMBL: ENSMUSP00000148107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005051] [ENSMUST00000048209] [ENSMUST00000092621] [ENSMUST00000125862] [ENSMUST00000132157] [ENSMUST00000133062] [ENSMUST00000147535] [ENSMUST00000209548] [ENSMUST00000209984] [ENSMUST00000210467] [ENSMUST00000210631] [ENSMUST00000210815] [ENSMUST00000210968]
AlphaFold P06151
Predicted Effect possibly damaging
Transcript: ENSMUST00000005051
AA Change: N115K

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103267
Gene: ENSMUSG00000063229
AA Change: N115K

DomainStartEndE-ValueType
Pfam:Ldh_1_N 50 189 2.5e-52 PFAM
Pfam:Ldh_1_C 192 360 2.7e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000048209
AA Change: N115K

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036386
Gene: ENSMUSG00000063229
AA Change: N115K

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 3e-53 PFAM
Pfam:Ldh_1_C 163 331 1.2e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092621
AA Change: N115K

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097661
Gene: ENSMUSG00000063229
AA Change: N115K

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 3.9e-54 PFAM
Pfam:Ldh_1_C 163 237 3.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125862
Predicted Effect possibly damaging
Transcript: ENSMUST00000132157
AA Change: N115K

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000133062
Predicted Effect possibly damaging
Transcript: ENSMUST00000147535
AA Change: N115K

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123356
Gene: ENSMUSG00000063229
AA Change: N115K

DomainStartEndE-ValueType
Pfam:Ldh_1_N 58 197 5.7e-54 PFAM
Pfam:Ldh_1_C 200 273 5.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209548
AA Change: N115K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000209984
AA Change: N144K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210467
AA Change: N115K

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect unknown
Transcript: ENSMUST00000210631
AA Change: H107D
Predicted Effect possibly damaging
Transcript: ENSMUST00000210815
AA Change: N98K

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000210968
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: The protein encoded by this gene catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. The protein is found predominantly in muscle tissue and belongs to the lactate dehydrogenase family. Mutations in this gene have been linked to hemolytic anemia and early postimplantation death in mice. Multiple transcript variants encoding different isoforms have been found for this gene. The mouse genome contains multiple pseudogenes of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for one chemically induced mutation exhibit severe hemolytic anemia with pronounced reticulocytosis and hyperbilirubinemia. Another mutation results in prenatal lethality in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Ldha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Ldha APN 7 46850178 missense possibly damaging 0.79
IGL01993:Ldha APN 7 46855100 missense possibly damaging 0.73
IGL02814:Ldha APN 7 46850891 nonsense probably null
R0530:Ldha UTSW 7 46853993 missense probably damaging 0.99
R1302:Ldha UTSW 7 46847639 missense probably damaging 1.00
R4948:Ldha UTSW 7 46847381 missense probably benign 0.00
R5327:Ldha UTSW 7 46854098 missense probably benign
R5413:Ldha UTSW 7 46850896 missense possibly damaging 0.54
R5543:Ldha UTSW 7 46850890 missense possibly damaging 0.94
R5763:Ldha UTSW 7 46847789 intron probably benign
R7232:Ldha UTSW 7 46850899 missense probably benign 0.31
R7660:Ldha UTSW 7 46850257 missense unknown
R8155:Ldha UTSW 7 46854084 missense probably damaging 1.00
R9025:Ldha UTSW 7 46851009 missense unknown
Predicted Primers PCR Primer
(F):5'- GATGGAACTGTCTACACTGGAG -3'
(R):5'- ACTACATTCAGAGGCATTTACGC -3'

Sequencing Primer
(F):5'- AACTGTCTACACTGGAGGTTTATGC -3'
(R):5'- GGCATTTACGCTTTAAAATGAGCTG -3'
Posted On 2021-07-15