Mutagenetix > Incidental Mutation

Incidental Mutation 'R8830:Agbl1'

673746

Institutional Source

Beutler Lab

Gene Symbol

Agbl1

Ensembl Gene

ENSMUSG00000025754

Gene Name

ATP/GTP binding protein-like 1

Synonyms

Nna1-l1, EG244071

Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8830 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76229887-77124698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76335311 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 159 (T159A)

Ref Sequence

ENSEMBL: ENSMUSP00000119721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000156166]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: T159A

Domain	Start	End	E-Value	Type
low complexity region	254	270	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	G	A	13: 64,297,300	Q170*	probably null	Het
Abca7	T	A	10: 80,008,971	V1509E	probably damaging	Het
Abraxas2	A	G	7: 132,883,356	D376G	probably damaging	Het
Ahnak2	G	A	12: 112,787,036	R89W		Het
Arhgef40	A	C	14: 52,003,708	D1396A	probably damaging	Het
Atp13a5	A	T	16: 29,248,176	F1060I	probably damaging	Het
Atp6v1c1	T	A	15: 38,677,545	F105I	probably damaging	Het
Atp9b	C	T	18: 80,765,800	E635K		Het
BC017643	C	T	11: 121,228,723		probably benign	Het
Brix1	T	A	15: 10,479,596	Q124L	possibly damaging	Het
Cep68	A	G	11: 20,230,418		probably benign	Het
Cfap46	A	G	7: 139,615,649	S2208P	unknown	Het
Crisp1	T	A	17: 40,294,419	K234*	probably null	Het
Cryzl1	C	T	16: 91,712,204	V70I	probably benign	Het
Dnah7b	T	C	1: 46,191,793	Y1404H	probably damaging	Het
Dot1l	A	G	10: 80,771,199	H109R	possibly damaging	Het
E330034G19Rik	A	C	14: 24,309,508	H329P	unknown	Het
Erbb4	A	T	1: 68,075,468	L939Q	probably damaging	Het
Fst	A	T	13: 114,455,828	C118S	probably damaging	Het
Gfra3	A	G	18: 34,711,136	V117A	possibly damaging	Het
Gldc	C	G	19: 30,100,812	M928I	probably benign	Het
Gm5538	A	T	3: 59,747,323	T193S	probably benign	Het
Gm996	T	G	2: 25,577,250	D883A		Het
Greb1	A	G	12: 16,688,519	M1481T	probably benign	Het
Hecw2	G	A	1: 53,891,146	R1045C	probably damaging	Het
Hexb	C	T	13: 97,194,254	V84I	probably benign	Het
Hpse	T	C	5: 100,695,586	E240G	probably benign	Het
Hspa12a	T	C	19: 58,805,463	D322G	possibly damaging	Het
Hspa9	A	T	18: 34,948,104		probably null	Het
Kif9	A	G	9: 110,524,930	K790R	probably damaging	Het
Klc2	C	T	19: 5,110,366		probably null	Het
Ldha	C	G	7: 46,850,278	N144K	probably benign	Het
Micalcl	A	G	7: 112,381,196	T126A	probably benign	Het
Mrpl15	A	T	1: 4,782,584	V137D	probably damaging	Het
Muc16	G	A	9: 18,646,069	T2976I	unknown	Het
Mybpc2	A	T	7: 44,512,541	V495D	probably damaging	Het
Olfr597	A	G	7: 103,321,005	K198R		Het
Olfr713	A	G	7: 107,036,682	N176D	probably benign	Het
Olfr772	A	T	10: 129,174,846	Y58*	probably null	Het
Pcnt	G	A	10: 76,382,174	T2089I	probably benign	Het
Pdzd7	T	C	19: 45,033,073	D563G	probably damaging	Het
Phlpp1	T	G	1: 106,350,603	L915R	probably damaging	Het
Plekhh2	T	A	17: 84,521,803	I34N	probably damaging	Het
Pou6f2	T	A	13: 18,378,498	T84S		Het
Ptprq	A	G	10: 107,586,695	V1612A	possibly damaging	Het
Pvrig	T	G	5: 138,342,148		probably benign	Het
Rasl10b	A	T	11: 83,412,676	I20F	probably damaging	Het
Rimbp3	T	A	16: 17,209,006	V98E	probably damaging	Het
Rims2	T	C	15: 39,437,362	I355T	possibly damaging	Het
Slc1a2	A	G	2: 102,736,015	H30R	probably benign	Het
Slc28a1	G	A	7: 81,161,046	V389M	possibly damaging	Het
Slc7a13	T	C	4: 19,819,189	S130P	probably benign	Het
Sp140	TTTTTTTT	TTTTTTTTTTTTT	1: 85,644,574		probably benign	Het
Spag17	T	A	3: 100,125,435	H2320Q	possibly damaging	Het
Speer4a	T	C	5: 26,036,795	E111G	possibly damaging	Het
Ss18l1	T	C	2: 180,067,338	Y397H	unknown	Het
Tbck	T	C	3: 132,838,057	S890P	probably damaging	Het
Tcp11	T	C	17: 28,080,230	E17G	probably benign	Het
Tesk2	C	T	4: 116,802,287	R315C	probably benign	Het
Tln1	T	C	4: 43,556,383	N45S	probably benign	Het
Trim10	C	T	17: 36,869,954	P26S	probably damaging	Het
Vmac	C	A	17: 56,715,573	G146C	probably damaging	Het
Vmn1r14	G	A	6: 57,234,032	M198I	probably damaging	Het
Vmn1r194	T	C	13: 22,244,836	Y208H	possibly damaging	Het
Vmn1r78	G	A	7: 12,153,191	C243Y	probably damaging	Het
Wasf3	C	T	5: 146,466,862	Q261*	probably null	Het
Ybx2	A	G	11: 69,936,237	K88R	probably benign	Het
Zfhx4	G	A	3: 5,398,889	R1394H	probably damaging	Het
Zfp871	T	C	17: 32,774,927	T425A	probably benign	Het
Zfy2	C	T	Y: 2,106,600	S678N	possibly damaging	Het
Zswim4	T	C	8: 84,223,316	E650G	possibly damaging	Het

Other mutations in Agbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01567:Agbl1	APN	7	76421880	missense	probably benign	0.01
IGL01650:Agbl1	APN	7	76420319	missense	probably damaging	1.00
IGL02244:Agbl1	APN	7	76766372	missense	probably damaging	1.00
IGL03088:Agbl1	APN	7	76720142	missense	probably benign	0.12
IGL03143:Agbl1	APN	7	76420045	nonsense	probably null
IGL03306:Agbl1	APN	7	76589504	missense	probably damaging	1.00
R0001:Agbl1	UTSW	7	76419863	missense	probably damaging	0.98
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0541:Agbl1	UTSW	7	76409245	missense	probably benign	0.22
R1889:Agbl1	UTSW	7	76589381	missense	probably damaging	1.00
R2089:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2127:Agbl1	UTSW	7	76419880	missense	possibly damaging	0.64
R2148:Agbl1	UTSW	7	76414717	splice site	probably null
R2229:Agbl1	UTSW	7	76433378	missense	probably benign	0.43
R2243:Agbl1	UTSW	7	76418722	missense	possibly damaging	0.93
R2255:Agbl1	UTSW	7	76422184	missense	probably damaging	1.00
R2411:Agbl1	UTSW	7	76720150	missense	probably damaging	1.00
R2426:Agbl1	UTSW	7	76421902	missense	probably damaging	1.00
R2508:Agbl1	UTSW	7	76589550	critical splice donor site	probably null
R2910:Agbl1	UTSW	7	76419838	missense	probably benign	0.13
R2919:Agbl1	UTSW	7	76414658	missense	probably damaging	1.00
R3056:Agbl1	UTSW	7	76766484	missense	possibly damaging	0.60
R3153:Agbl1	UTSW	7	76720196	missense	probably damaging	1.00
R3770:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R3825:Agbl1	UTSW	7	76419967	missense	probably damaging	0.99
R4632:Agbl1	UTSW	7	76413685	missense	probably benign	0.00
R4857:Agbl1	UTSW	7	76419835	missense	probably benign	0.03
R4943:Agbl1	UTSW	7	76420016	missense	probably benign	0.01
R5055:Agbl1	UTSW	7	76413577	missense	probably damaging	1.00
R5071:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5072:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5074:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5095:Agbl1	UTSW	7	76720133	missense	probably damaging	0.96
R5133:Agbl1	UTSW	7	76422156	missense	probably benign	0.21
R5576:Agbl1	UTSW	7	76335237	missense	probably benign	0.03
R5665:Agbl1	UTSW	7	76589503	missense	probably damaging	1.00
R5849:Agbl1	UTSW	7	76325098	missense	probably benign	0.35
R5924:Agbl1	UTSW	7	76409234	missense	probably benign	0.12
R6044:Agbl1	UTSW	7	76318120	missense	possibly damaging	0.56
R6117:Agbl1	UTSW	7	76698786	missense	probably damaging	1.00
R6144:Agbl1	UTSW	7	76420084	missense	probably benign	0.02
R6368:Agbl1	UTSW	7	76419830	missense	probably benign	0.25
R6806:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7455:Agbl1	UTSW	7	76424755	missense	unknown
R7459:Agbl1	UTSW	7	76420066	missense	not run
R7485:Agbl1	UTSW	7	76589493	missense	unknown
R7516:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7539:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R7561:Agbl1	UTSW	7	76698761	missense	unknown
R7630:Agbl1	UTSW	7	76886156	missense	unknown
R7655:Agbl1	UTSW	7	76409332	missense
R7656:Agbl1	UTSW	7	76409332	missense
R7658:Agbl1	UTSW	7	76766369	missense	unknown
R7681:Agbl1	UTSW	7	76444901	missense	unknown
R7694:Agbl1	UTSW	7	76698765	missense	unknown
R7773:Agbl1	UTSW	7	76698837	missense	unknown
R7981:Agbl1	UTSW	7	76444840	missense	unknown
R8208:Agbl1	UTSW	7	76720168	missense	unknown
R8317:Agbl1	UTSW	7	76422181	missense	unknown
R8406:Agbl1	UTSW	7	76418667	missense
R8432:Agbl1	UTSW	7	77124686	missense	unknown
R8704:Agbl1	UTSW	7	76589554	splice site	probably benign
R8985:Agbl1	UTSW	7	76320156	missense
R9113:Agbl1	UTSW	7	76589477	missense	unknown
R9170:Agbl1	UTSW	7	76335321	missense
R9229:Agbl1	UTSW	7	77124522	missense	unknown
R9255:Agbl1	UTSW	7	76766402	missense	unknown
R9391:Agbl1	UTSW	7	76421854	missense	unknown
Z1088:Agbl1	UTSW	7	76419904	missense	probably benign	0.00
Z1176:Agbl1	UTSW	7	76418685	missense
Z1177:Agbl1	UTSW	7	76720206	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTACCCTACTCACTAGGCTG -3'
(R):5'- AACTTGGGGTTGGGTAGAGA -3'

Sequencing Primer
(F):5'- CCTACTCACTAGGCTGTTAAGAGAG -3'
(R):5'- AAGCAGATTGATATGGGATAGAGCC -3'

Posted On

2021-07-15