Incidental Mutation 'R8830:Olfr597'
ID 673748
Institutional Source Beutler Lab
Gene Symbol Olfr597
Ensembl Gene ENSMUSG00000073952
Gene Name olfactory receptor 597
Synonyms GA_x6K02T2PBJ9-6029614-6030561, MOR23-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103316315-103322799 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103321005 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 198 (K198R)
Ref Sequence ENSEMBL: ENSMUSP00000150238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098203] [ENSMUST00000214765] [ENSMUST00000216456]
AlphaFold L7N224
Predicted Effect
SMART Domains Protein: ENSMUSP00000095804
Gene: ENSMUSG00000073952
AA Change: K198R

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 2.2e-89 PFAM
Pfam:7TM_GPCR_Srsx 41 312 5.7e-7 PFAM
Pfam:7tm_1 47 297 3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214765
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Olfr597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Olfr597 APN 7 103321334 missense probably benign 0.27
IGL01872:Olfr597 APN 7 103320972 missense probably benign 0.17
IGL02797:Olfr597 APN 7 103320851 missense probably benign
IGL02811:Olfr597 APN 7 103320933 missense probably benign
PIT4131001:Olfr597 UTSW 7 103320869 nonsense probably null
R1800:Olfr597 UTSW 7 103320414 start codon destroyed probably null 0.98
R4921:Olfr597 UTSW 7 103320543 missense probably damaging 1.00
R6288:Olfr597 UTSW 7 103321079 missense probably damaging 0.97
R6993:Olfr597 UTSW 7 103320791 unclassified probably benign
R7043:Olfr597 UTSW 7 103321085 unclassified probably benign
R7322:Olfr597 UTSW 7 103321287 missense
R7472:Olfr597 UTSW 7 103320449 missense
R7704:Olfr597 UTSW 7 103320771 missense
R8393:Olfr597 UTSW 7 103320461 missense
R8418:Olfr597 UTSW 7 103321071 missense
R8867:Olfr597 UTSW 7 103321242 missense
Predicted Primers PCR Primer
(F):5'- TGTGATCCTCTGAGGCACAC -3'
(R):5'- CAACCCGCTTTCGAATGACC -3'

Sequencing Primer
(F):5'- TGAGGCACACATCTATTCTTACAC -3'
(R):5'- CTCCATACACAATAGGGTTGAGAGC -3'
Posted On 2021-07-15