Incidental Mutation 'R8830:Olfr713'
ID 673749
Institutional Source Beutler Lab
Gene Symbol Olfr713
Ensembl Gene ENSMUSG00000073898
Gene Name olfactory receptor 713
Synonyms GA_x6K02T2PBJ9-9415724-9416677, MOR263-1, P3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 107031174-107040994 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107036682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 176 (N176D)
Ref Sequence ENSEMBL: ENSMUSP00000150042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098139] [ENSMUST00000213623]
AlphaFold Q920G5
Predicted Effect probably benign
Transcript: ENSMUST00000098139
AA Change: N183D

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095743
Gene: ENSMUSG00000073898
AA Change: N183D

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.4e-57 PFAM
Pfam:7tm_1 49 298 2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213623
AA Change: N176D

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Olfr713
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr713 APN 7 107036847 missense probably damaging 0.99
IGL01630:Olfr713 APN 7 107037111 utr 3 prime probably benign
IGL02539:Olfr713 APN 7 107036434 missense probably damaging 1.00
IGL02727:Olfr713 APN 7 107036695 missense probably damaging 1.00
IGL03336:Olfr713 APN 7 107036335 missense probably damaging 1.00
R0501:Olfr713 UTSW 7 107036232 missense probably benign
R0684:Olfr713 UTSW 7 107036682 missense probably damaging 1.00
R0909:Olfr713 UTSW 7 107036194 missense probably benign 0.19
R1481:Olfr713 UTSW 7 107036149 missense probably benign 0.05
R1958:Olfr713 UTSW 7 107036271 missense possibly damaging 0.77
R1965:Olfr713 UTSW 7 107036358 missense probably damaging 1.00
R2119:Olfr713 UTSW 7 107036731 missense probably damaging 1.00
R2149:Olfr713 UTSW 7 107036338 missense possibly damaging 0.68
R3012:Olfr713 UTSW 7 107036362 missense possibly damaging 0.79
R3428:Olfr713 UTSW 7 107036716 missense probably benign
R4425:Olfr713 UTSW 7 107036491 missense probably damaging 1.00
R4795:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4796:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4908:Olfr713 UTSW 7 107036157 start codon destroyed probably benign 0.02
R4945:Olfr713 UTSW 7 107036319 missense probably benign 0.00
R5122:Olfr713 UTSW 7 107036848 nonsense probably null
R5721:Olfr713 UTSW 7 107036358 missense probably damaging 1.00
R5979:Olfr713 UTSW 7 107036336 missense probably damaging 1.00
R6739:Olfr713 UTSW 7 107036811 missense probably damaging 1.00
R6981:Olfr713 UTSW 7 107036749 missense possibly damaging 0.77
R7197:Olfr713 UTSW 7 107036157 missense probably benign 0.03
R7228:Olfr713 UTSW 7 107037100 missense probably benign
R7444:Olfr713 UTSW 7 107036347 missense probably damaging 1.00
R9109:Olfr713 UTSW 7 107036433 missense probably damaging 1.00
R9298:Olfr713 UTSW 7 107036433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATATGACCGCTATGTGGC -3'
(R):5'- GGCCTAAAGTAAGTGAGGCTTG -3'

Sequencing Primer
(F):5'- ATATGACCGCTATGTGGCCATCTG -3'
(R):5'- AGAAGGCTTTGTGCTTCCC -3'
Posted On 2021-07-15