Incidental Mutation 'R8830:Ybx2'
ID 673761
Institutional Source Beutler Lab
Gene Symbol Ybx2
Ensembl Gene ENSMUSG00000018554
Gene Name Y box protein 2
Synonyms MSY2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock # R8830 (G1)
Quality Score 146.008
Status Validated
Chromosome 11
Chromosomal Location 69935796-69941605 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69936237 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 88 (K88R)
Ref Sequence ENSEMBL: ENSMUSP00000018698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018698] [ENSMUST00000108601] [ENSMUST00000149194]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018698
AA Change: K88R

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018698
Gene: ENSMUSG00000018554
AA Change: K88R

DomainStartEndE-ValueType
low complexity region 2 68 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
CSP 96 164 2.54e-21 SMART
low complexity region 173 212 N/A INTRINSIC
low complexity region 220 242 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108601
SMART Domains Protein: ENSMUSP00000104242
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
CSP 19 87 2.54e-21 SMART
low complexity region 96 135 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 197 217 N/A INTRINSIC
low complexity region 240 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149194
SMART Domains Protein: ENSMUSP00000136684
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 122 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleic acid binding protein which is highly expressed in germ cells. The encoded protein binds to a Y-box element in the promoters of certain genes but also binds to mRNA transcribed from these genes. Pseudogenes for this gene are located on chromosome 10 and 15. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous disruption of this gene leads to both male and female infertility. Spermatogenesis terminates in postmeiotic germ cells with no sperm seen in the epididymis and a marked increase of apoptosis during meiosis. Adult females exhibit a few growingfollicles and no corpora lutea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Ybx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ybx2 APN 11 69940730 missense probably damaging 0.97
IGL02720:Ybx2 APN 11 69940331 missense probably benign
IGL02720:Ybx2 APN 11 69940332 missense probably benign 0.09
PIT4515001:Ybx2 UTSW 11 69940398 missense probably benign 0.41
R0158:Ybx2 UTSW 11 69940319 unclassified probably benign
R1697:Ybx2 UTSW 11 69940061 missense probably benign 0.40
R1985:Ybx2 UTSW 11 69936468 splice site probably null
R3969:Ybx2 UTSW 11 69940416 missense probably damaging 0.99
R4209:Ybx2 UTSW 11 69935941 start gained probably benign
R5963:Ybx2 UTSW 11 69941092 missense probably damaging 1.00
R6378:Ybx2 UTSW 11 69940353 missense possibly damaging 0.73
R7325:Ybx2 UTSW 11 69940355 missense probably benign 0.22
R7982:Ybx2 UTSW 11 69940622 missense possibly damaging 0.94
R8310:Ybx2 UTSW 11 69940368 missense probably damaging 0.96
R9443:Ybx2 UTSW 11 69940362 missense
X0062:Ybx2 UTSW 11 69938348 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGTGTACTTACGGAGTTGC -3'
(R):5'- ATTTCCCTCCAGCGGAATC -3'

Sequencing Primer
(F):5'- TGCGCGGCTACGATTGG -3'
(R):5'- CCACTAATAGTTTATTCGGCAGC -3'
Posted On 2021-07-15