Incidental Mutation 'R8830:Fst'
ID 673769
Institutional Source Beutler Lab
Gene Symbol Fst
Ensembl Gene ENSMUSG00000021765
Gene Name follistatin
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 114452290-114458951 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114455828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 118 (C118S)
Ref Sequence ENSEMBL: ENSMUSP00000022287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022287] [ENSMUST00000223640] [ENSMUST00000231252]
AlphaFold P47931
Predicted Effect probably damaging
Transcript: ENSMUST00000022287
AA Change: C118S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022287
Gene: ENSMUSG00000021765
AA Change: C118S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FOLN 94 117 2.44e-8 SMART
KAZAL 117 164 9.1e-17 SMART
FOLN 167 190 6.45e-8 SMART
KAZAL 191 239 3.73e-13 SMART
FOLN 243 267 2.09e-7 SMART
KAZAL 265 315 3.03e-13 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223640
AA Change: C118S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000225068
Predicted Effect probably damaging
Transcript: ENSMUST00000231252
AA Change: C118S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9444 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice show retarded growth, reduced diaphragm and intercostal muscle mass that lead to neonatal respiratory failure, shiny tight skin, defects of the hard palate and thirteenth ribs, and abnormal whiskers and teeth. Some conditional mutations produce female reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Fst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Fst APN 13 114454360 missense probably damaging 1.00
IGL02213:Fst APN 13 114455854 missense possibly damaging 0.51
R0631:Fst UTSW 13 114454502 missense possibly damaging 0.91
R1391:Fst UTSW 13 114454279 critical splice donor site probably benign
R4884:Fst UTSW 13 114454384 missense probably damaging 1.00
R5326:Fst UTSW 13 114455705 missense probably damaging 1.00
R5542:Fst UTSW 13 114455705 missense probably damaging 1.00
R6700:Fst UTSW 13 114458507 missense probably benign 0.00
R7319:Fst UTSW 13 114458532 missense probably benign 0.09
R8281:Fst UTSW 13 114455241 missense probably benign 0.02
R8910:Fst UTSW 13 114453709 intron probably benign
Predicted Primers PCR Primer
(F):5'- TATCGCCCTTGGGTCTTCAAAG -3'
(R):5'- CCATCTCGGATGCATGATTGCTC -3'

Sequencing Primer
(F):5'- CTTTGAATGTATAGAGATGCTGAAGG -3'
(R):5'- GCATGATTGCTCAAGACATCTGAGAC -3'
Posted On 2021-07-15