Incidental Mutation 'R8830:Arhgef40'
ID 673771
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene Name Rho guanine nucleotide exchange factor 40
Synonyms E130112L23Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52222176-52243708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 52241165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 1396 (D1396A)
Ref Sequence ENSEMBL: ENSMUSP00000091331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067549] [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000166169] [ENSMUST00000182061] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208] [ENSMUST00000226522] [ENSMUST00000228580]
AlphaFold Q3UPH7
Predicted Effect probably benign
Transcript: ENSMUST00000067549
SMART Domains Protein: ENSMUSP00000068184
Gene: ENSMUSG00000049295

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093813
AA Change: D1396A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: D1396A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100639
AA Change: D1396A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: D1396A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166169
SMART Domains Protein: ENSMUSP00000126854
Gene: ENSMUSG00000049295

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182061
AA Change: D1396A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: D1396A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182217
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000182760
AA Change: D1405A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: D1405A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182828
Predicted Effect probably benign
Transcript: ENSMUST00000182905
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: D1396A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226522
Predicted Effect probably benign
Transcript: ENSMUST00000228580
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm2 A T 3: 59,654,744 (GRCm39) T193S probably benign Het
Abca7 T A 10: 79,844,805 (GRCm39) V1509E probably damaging Het
Abraxas2 A G 7: 132,485,085 (GRCm39) D376G probably damaging Het
Agbl1 A G 7: 75,985,059 (GRCm39) T159A Het
Ahnak2 G A 12: 112,750,656 (GRCm39) R89W Het
Ajm1 T G 2: 25,467,262 (GRCm39) D883A Het
Atp13a5 A T 16: 29,066,928 (GRCm39) F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,789 (GRCm39) F105I probably damaging Het
Atp9b C T 18: 80,809,015 (GRCm39) E635K Het
Brix1 T A 15: 10,479,682 (GRCm39) Q124L possibly damaging Het
Cep68 A G 11: 20,180,418 (GRCm39) probably benign Het
Cfap46 A G 7: 139,195,565 (GRCm39) S2208P unknown Het
Crisp1 T A 17: 40,605,310 (GRCm39) K234* probably null Het
Cryzl1 C T 16: 91,509,092 (GRCm39) V70I probably benign Het
Cybc1 C T 11: 121,119,549 (GRCm39) probably benign Het
Dnah7b T C 1: 46,230,953 (GRCm39) Y1404H probably damaging Het
Dot1l A G 10: 80,607,033 (GRCm39) H109R possibly damaging Het
E330034G19Rik A C 14: 24,359,576 (GRCm39) H329P unknown Het
Erbb4 A T 1: 68,114,627 (GRCm39) L939Q probably damaging Het
Fst A T 13: 114,592,364 (GRCm39) C118S probably damaging Het
Gfra3 A G 18: 34,844,189 (GRCm39) V117A possibly damaging Het
Gldc C G 19: 30,078,212 (GRCm39) M928I probably benign Het
Greb1 A G 12: 16,738,520 (GRCm39) M1481T probably benign Het
Hecw2 G A 1: 53,930,305 (GRCm39) R1045C probably damaging Het
Hexb C T 13: 97,330,762 (GRCm39) V84I probably benign Het
Hpse T C 5: 100,843,452 (GRCm39) E240G probably benign Het
Hspa12a T C 19: 58,793,895 (GRCm39) D322G possibly damaging Het
Hspa9 A T 18: 35,081,157 (GRCm39) probably null Het
Kif9 A G 9: 110,353,998 (GRCm39) K790R probably damaging Het
Klc2 C T 19: 5,160,394 (GRCm39) probably null Het
Ldha C G 7: 46,499,702 (GRCm39) N144K probably benign Het
Mical2 A G 7: 111,980,403 (GRCm39) T126A probably benign Het
Mrpl15 A T 1: 4,852,807 (GRCm39) V137D probably damaging Het
Muc16 G A 9: 18,557,365 (GRCm39) T2976I unknown Het
Mybpc2 A T 7: 44,161,965 (GRCm39) V495D probably damaging Het
Or10a5 A G 7: 106,635,889 (GRCm39) N176D probably benign Het
Or52ab2 A G 7: 102,970,212 (GRCm39) K198R Het
Or6c203 A T 10: 129,010,715 (GRCm39) Y58* probably null Het
Pcnt G A 10: 76,218,008 (GRCm39) T2089I probably benign Het
Pdzd7 T C 19: 45,021,512 (GRCm39) D563G probably damaging Het
Phlpp1 T G 1: 106,278,333 (GRCm39) L915R probably damaging Het
Plekhh2 T A 17: 84,829,231 (GRCm39) I34N probably damaging Het
Pou6f2 T A 13: 18,553,083 (GRCm39) T84S Het
Prxl2c G A 13: 64,445,114 (GRCm39) Q170* probably null Het
Ptprq A G 10: 107,422,556 (GRCm39) V1612A possibly damaging Het
Pvrig-ps T G 5: 138,340,410 (GRCm39) probably benign Het
Rasl10b A T 11: 83,303,502 (GRCm39) I20F probably damaging Het
Rimbp3 T A 16: 17,026,870 (GRCm39) V98E probably damaging Het
Rims2 T C 15: 39,300,758 (GRCm39) I355T possibly damaging Het
Slc1a2 A G 2: 102,566,360 (GRCm39) H30R probably benign Het
Slc28a1 G A 7: 80,810,794 (GRCm39) V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 (GRCm39) S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,572,295 (GRCm39) probably benign Het
Spag17 T A 3: 100,032,751 (GRCm39) H2320Q possibly damaging Het
Speer4a1 T C 5: 26,241,793 (GRCm39) E111G possibly damaging Het
Ss18l1 T C 2: 179,709,131 (GRCm39) Y397H unknown Het
Tbck T C 3: 132,543,818 (GRCm39) S890P probably damaging Het
Tcp11 T C 17: 28,299,204 (GRCm39) E17G probably benign Het
Tesk2 C T 4: 116,659,484 (GRCm39) R315C probably benign Het
Tln1 T C 4: 43,556,383 (GRCm39) N45S probably benign Het
Trim10 C T 17: 37,180,846 (GRCm39) P26S probably damaging Het
Vmac C A 17: 57,022,573 (GRCm39) G146C probably damaging Het
Vmn1r14 G A 6: 57,211,017 (GRCm39) M198I probably damaging Het
Vmn1r194 T C 13: 22,429,006 (GRCm39) Y208H possibly damaging Het
Vmn1r78 G A 7: 11,887,118 (GRCm39) C243Y probably damaging Het
Wasf3 C T 5: 146,403,672 (GRCm39) Q261* probably null Het
Ybx2 A G 11: 69,827,063 (GRCm39) K88R probably benign Het
Zfhx4 G A 3: 5,463,949 (GRCm39) R1394H probably damaging Het
Zfp871 T C 17: 32,993,901 (GRCm39) T425A probably benign Het
Zfy2 C T Y: 2,106,600 (GRCm39) S678N possibly damaging Het
Zswim4 T C 8: 84,949,945 (GRCm39) E650G possibly damaging Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 52,226,417 (GRCm39) missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 52,224,884 (GRCm39) missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 52,229,155 (GRCm39) critical splice donor site probably null
IGL01123:Arhgef40 APN 14 52,231,803 (GRCm39) missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 52,226,862 (GRCm39) missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 52,226,652 (GRCm39) missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52,238,320 (GRCm39) missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 52,234,865 (GRCm39) missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 52,234,431 (GRCm39) missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52,242,364 (GRCm39) unclassified probably benign
R0608:Arhgef40 UTSW 14 52,234,431 (GRCm39) missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52,238,450 (GRCm39) missense probably benign 0.05
R1126:Arhgef40 UTSW 14 52,234,583 (GRCm39) missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 52,227,613 (GRCm39) missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52,241,538 (GRCm39) missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 52,227,387 (GRCm39) missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 52,235,080 (GRCm39) missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52,241,162 (GRCm39) missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 52,233,640 (GRCm39) missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 52,231,733 (GRCm39) splice site probably benign
R3877:Arhgef40 UTSW 14 52,239,742 (GRCm39) missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 52,227,628 (GRCm39) missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 52,224,681 (GRCm39) critical splice donor site probably null
R4676:Arhgef40 UTSW 14 52,228,416 (GRCm39) nonsense probably null
R4703:Arhgef40 UTSW 14 52,239,767 (GRCm39) missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52,239,767 (GRCm39) missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52,242,395 (GRCm39) unclassified probably benign
R4915:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 52,227,146 (GRCm39) missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52,241,556 (GRCm39) missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 52,227,269 (GRCm39) missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 52,227,156 (GRCm39) missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 52,229,306 (GRCm39) missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 52,233,614 (GRCm39) missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 52,231,795 (GRCm39) missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52,238,357 (GRCm39) missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 52,234,489 (GRCm39) missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 52,224,953 (GRCm39) missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 52,227,547 (GRCm39) missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52,238,456 (GRCm39) missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 52,234,888 (GRCm39) missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 52,228,419 (GRCm39) unclassified probably benign
R6675:Arhgef40 UTSW 14 52,229,098 (GRCm39) missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 52,235,354 (GRCm39) intron probably benign
R6901:Arhgef40 UTSW 14 52,234,825 (GRCm39) missense probably damaging 1.00
R7852:Arhgef40 UTSW 14 52,229,254 (GRCm39) missense unknown
R7857:Arhgef40 UTSW 14 52,226,212 (GRCm39) missense probably damaging 0.97
R7914:Arhgef40 UTSW 14 52,225,032 (GRCm39) missense probably damaging 1.00
R8060:Arhgef40 UTSW 14 52,222,452 (GRCm39) splice site probably benign
R8144:Arhgef40 UTSW 14 52,235,632 (GRCm39) missense probably damaging 1.00
R8195:Arhgef40 UTSW 14 52,226,226 (GRCm39) missense probably damaging 1.00
R8432:Arhgef40 UTSW 14 52,226,857 (GRCm39) missense probably benign 0.00
R8738:Arhgef40 UTSW 14 52,238,414 (GRCm39) missense probably damaging 1.00
R9038:Arhgef40 UTSW 14 52,235,072 (GRCm39) missense probably damaging 0.96
R9712:Arhgef40 UTSW 14 52,226,415 (GRCm39) missense probably damaging 0.99
U24488:Arhgef40 UTSW 14 52,235,673 (GRCm39) missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52,241,141 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCCTTGATAGCCGGGAAAG -3'
(R):5'- AACAGCTCACAGAGGGCTTC -3'

Sequencing Primer
(F):5'- CTTGATAGCCGGGAAAGGGGAG -3'
(R):5'- GGGCTTCCCAGGGAACC -3'
Posted On 2021-07-15