Incidental Mutation 'R8830:Atp6v1c1'
ID 673773
Institutional Source Beutler Lab
Gene Symbol Atp6v1c1
Ensembl Gene ENSMUSG00000022295
Gene Name ATPase, H+ transporting, lysosomal V1 subunit C1
Synonyms 1700025B18Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 38661933-38692446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38677545 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 105 (F105I)
Ref Sequence ENSEMBL: ENSMUSP00000022904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022904] [ENSMUST00000226533] [ENSMUST00000228820]
AlphaFold Q9Z1G3
Predicted Effect probably damaging
Transcript: ENSMUST00000022904
AA Change: F105I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022904
Gene: ENSMUSG00000022295
AA Change: F105I

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 370 1.2e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226533
Predicted Effect probably benign
Transcript: ENSMUST00000228820
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene is one of two genes that encode the V1 domain C subunit proteins and is found ubiquitously. This C subunit is analogous but not homologous to gamma subunit of F-ATPases. Previously, this gene was designated ATP6D. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Atp6v1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Atp6v1c1 APN 15 38686856 missense probably damaging 0.99
IGL01371:Atp6v1c1 APN 15 38682960 missense probably benign
IGL02987:Atp6v1c1 APN 15 38690562 missense possibly damaging 0.70
P0029:Atp6v1c1 UTSW 15 38686902 unclassified probably benign
R0550:Atp6v1c1 UTSW 15 38682929 splice site probably benign
R0669:Atp6v1c1 UTSW 15 38677528 missense probably benign 0.00
R2033:Atp6v1c1 UTSW 15 38673966 critical splice donor site probably null
R3021:Atp6v1c1 UTSW 15 38689216 missense possibly damaging 0.75
R4475:Atp6v1c1 UTSW 15 38677573 missense probably benign 0.03
R4612:Atp6v1c1 UTSW 15 38677612 missense probably damaging 1.00
R4798:Atp6v1c1 UTSW 15 38689176 missense probably damaging 1.00
R5095:Atp6v1c1 UTSW 15 38679413 critical splice donor site probably null
R5600:Atp6v1c1 UTSW 15 38686863 missense probably benign 0.17
R6177:Atp6v1c1 UTSW 15 38673928 nonsense probably null
R6434:Atp6v1c1 UTSW 15 38677546 missense probably damaging 0.99
R6916:Atp6v1c1 UTSW 15 38677581 missense probably benign 0.00
R6973:Atp6v1c1 UTSW 15 38690550 missense probably damaging 1.00
R7395:Atp6v1c1 UTSW 15 38691705 makesense probably null
R7607:Atp6v1c1 UTSW 15 38683011 critical splice donor site probably null
R7712:Atp6v1c1 UTSW 15 38686805 missense probably benign 0.00
R9195:Atp6v1c1 UTSW 15 38673954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGTTAAAAGCAAGCAAAC -3'
(R):5'- TTTGGGACCACTAACCACAGG -3'

Sequencing Primer
(F):5'- TGGATCTCTAAGTTAAAGGCCAGCC -3'
(R):5'- AACCGTGATGGGTCGCTG -3'
Posted On 2021-07-15