Incidental Mutation 'R8830:Trim10'
ID 673780
Institutional Source Beutler Lab
Gene Symbol Trim10
Ensembl Gene ENSMUSG00000073400
Gene Name tripartite motif-containing 10
Synonyms Rnf9, Herf1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 36869574-36877833 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36869954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 26 (P26S)
Ref Sequence ENSEMBL: ENSMUSP00000057928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025329] [ENSMUST00000060524] [ENSMUST00000174195]
AlphaFold Q9WUH5
Predicted Effect probably benign
Transcript: ENSMUST00000025329
SMART Domains Protein: ENSMUSP00000025329
Gene: ENSMUSG00000050747

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060524
AA Change: P26S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057928
Gene: ENSMUSG00000073400
AA Change: P26S

DomainStartEndE-ValueType
RING 16 60 1.2e-7 SMART
BBOX 94 135 5.38e-10 SMART
coiled coil region 152 175 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
PRY 309 361 1.04e-25 SMART
SPRY 362 485 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173639
SMART Domains Protein: ENSMUSP00000133638
Gene: ENSMUSG00000050747

DomainStartEndE-ValueType
SCOP:d1dkza_ 15 105 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174195
SMART Domains Protein: ENSMUSP00000133953
Gene: ENSMUSG00000050747

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic bodies. Studies in mice suggest that this protein plays a role in terminal differentiation of erythroid cells. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Trim10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Trim10 APN 17 36877248 missense probably benign 0.03
IGL00501:Trim10 APN 17 36877047 missense probably benign 0.08
IGL00846:Trim10 APN 17 36871692 missense probably damaging 1.00
IGL01536:Trim10 APN 17 36877288 splice site probably null
IGL02814:Trim10 APN 17 36877336 nonsense probably null
IGL03135:Trim10 APN 17 36874221 missense possibly damaging 0.78
IGL03144:Trim10 APN 17 36876848 missense probably damaging 1.00
IGL03298:Trim10 APN 17 36877025 missense possibly damaging 0.87
PIT4378001:Trim10 UTSW 17 36877128 missense probably damaging 0.98
R0102:Trim10 UTSW 17 36870182 missense probably damaging 1.00
R0102:Trim10 UTSW 17 36870182 missense probably damaging 1.00
R0834:Trim10 UTSW 17 36872391 missense probably benign 0.00
R1517:Trim10 UTSW 17 36872454 missense probably damaging 1.00
R1691:Trim10 UTSW 17 36876899 missense probably damaging 1.00
R1696:Trim10 UTSW 17 36877181 nonsense probably null
R2149:Trim10 UTSW 17 36877014 missense probably benign 0.18
R3153:Trim10 UTSW 17 36871688 missense probably damaging 1.00
R3154:Trim10 UTSW 17 36871688 missense probably damaging 1.00
R5156:Trim10 UTSW 17 36877056 missense probably damaging 0.99
R5327:Trim10 UTSW 17 36870189 missense probably damaging 1.00
R5361:Trim10 UTSW 17 36875436 missense probably benign 0.03
R5758:Trim10 UTSW 17 36877152 missense possibly damaging 0.80
R5764:Trim10 UTSW 17 36870181 missense probably damaging 0.97
R6032:Trim10 UTSW 17 36871714 missense possibly damaging 0.87
R6032:Trim10 UTSW 17 36871714 missense possibly damaging 0.87
R6179:Trim10 UTSW 17 36877031 missense probably damaging 1.00
R6709:Trim10 UTSW 17 36872370 missense probably damaging 0.99
R7172:Trim10 UTSW 17 36870063 missense possibly damaging 0.78
R7197:Trim10 UTSW 17 36876954 missense probably damaging 1.00
R7390:Trim10 UTSW 17 36869881 start codon destroyed probably null 0.98
R7391:Trim10 UTSW 17 36869881 start codon destroyed probably null 0.98
R7696:Trim10 UTSW 17 36871752 missense probably damaging 1.00
R8867:Trim10 UTSW 17 36870156 missense probably benign 0.00
R8970:Trim10 UTSW 17 36873276 missense probably benign 0.00
R9376:Trim10 UTSW 17 36873276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTATGGTGCTTTGAGCCCC -3'
(R):5'- TTCTCCACCACATTGGCCAG -3'

Sequencing Primer
(F):5'- CCAGAGATGTAACTGGGTCCCTTG -3'
(R):5'- ATTCTGGACCTGGGATCT -3'
Posted On 2021-07-15