Mutagenetix > Incidental Mutation

Incidental Mutation 'R8830:Trim10'

673780

Institutional Source

Beutler Lab

Gene Symbol

Trim10

Ensembl Gene

ENSMUSG00000073400

Gene Name

tripartite motif-containing 10

Synonyms

Rnf9, Herf1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R8830 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36869574-36877833 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 36869954 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 26 (P26S)

Ref Sequence

ENSEMBL: ENSMUSP00000057928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025329] [ENSMUST00000060524] [ENSMUST00000174195]

AlphaFold

Q9WUH5

Predicted Effect

probably benign
Transcript: ENSMUST00000025329

SMART Domains

Protein: ENSMUSP00000025329
Gene: ENSMUSG00000050747

Domain	Start	End	E-Value	Type
RING	15	53	2e-4	SMART
BBOX	73	114	2.41e-12	SMART
coiled coil region	145	229	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000060524
AA Change: P26S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057928
Gene: ENSMUSG00000073400
AA Change: P26S

Domain	Start	End	E-Value	Type
RING	16	60	1.2e-7	SMART
BBOX	94	135	5.38e-10	SMART
coiled coil region	152	175	N/A	INTRINSIC
low complexity region	187	207	N/A	INTRINSIC
PRY	309	361	1.04e-25	SMART
SPRY	362	485	1.51e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173639

SMART Domains

Protein: ENSMUSP00000133638
Gene: ENSMUSG00000050747

Domain	Start	End	E-Value	Type
SCOP:d1dkza_	15	105	1e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174195

SMART Domains

Protein: ENSMUSP00000133953
Gene: ENSMUSG00000050747

Domain	Start	End	E-Value	Type
RING	15	53	2e-4	SMART
BBOX	73	114	2.41e-12	SMART
coiled coil region	145	229	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic bodies. Studies in mice suggest that this protein plays a role in terminal differentiation of erythroid cells. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	G	A	13: 64,297,300	Q170*	probably null	Het
Abca7	T	A	10: 80,008,971	V1509E	probably damaging	Het
Abraxas2	A	G	7: 132,883,356	D376G	probably damaging	Het
Agbl1	A	G	7: 76,335,311	T159A		Het
Ahnak2	G	A	12: 112,787,036	R89W		Het
Arhgef40	A	C	14: 52,003,708	D1396A	probably damaging	Het
Atp13a5	A	T	16: 29,248,176	F1060I	probably damaging	Het
Atp6v1c1	T	A	15: 38,677,545	F105I	probably damaging	Het
Atp9b	C	T	18: 80,765,800	E635K		Het
BC017643	C	T	11: 121,228,723		probably benign	Het
Brix1	T	A	15: 10,479,596	Q124L	possibly damaging	Het
Cep68	A	G	11: 20,230,418		probably benign	Het
Cfap46	A	G	7: 139,615,649	S2208P	unknown	Het
Crisp1	T	A	17: 40,294,419	K234*	probably null	Het
Cryzl1	C	T	16: 91,712,204	V70I	probably benign	Het
Dnah7b	T	C	1: 46,191,793	Y1404H	probably damaging	Het
Dot1l	A	G	10: 80,771,199	H109R	possibly damaging	Het
E330034G19Rik	A	C	14: 24,309,508	H329P	unknown	Het
Erbb4	A	T	1: 68,075,468	L939Q	probably damaging	Het
Fst	A	T	13: 114,455,828	C118S	probably damaging	Het
Gfra3	A	G	18: 34,711,136	V117A	possibly damaging	Het
Gldc	C	G	19: 30,100,812	M928I	probably benign	Het
Gm5538	A	T	3: 59,747,323	T193S	probably benign	Het
Gm996	T	G	2: 25,577,250	D883A		Het
Greb1	A	G	12: 16,688,519	M1481T	probably benign	Het
Hecw2	G	A	1: 53,891,146	R1045C	probably damaging	Het
Hexb	C	T	13: 97,194,254	V84I	probably benign	Het
Hpse	T	C	5: 100,695,586	E240G	probably benign	Het
Hspa12a	T	C	19: 58,805,463	D322G	possibly damaging	Het
Hspa9	A	T	18: 34,948,104		probably null	Het
Kif9	A	G	9: 110,524,930	K790R	probably damaging	Het
Klc2	C	T	19: 5,110,366		probably null	Het
Ldha	C	G	7: 46,850,278	N144K	probably benign	Het
Micalcl	A	G	7: 112,381,196	T126A	probably benign	Het
Mrpl15	A	T	1: 4,782,584	V137D	probably damaging	Het
Muc16	G	A	9: 18,646,069	T2976I	unknown	Het
Mybpc2	A	T	7: 44,512,541	V495D	probably damaging	Het
Olfr597	A	G	7: 103,321,005	K198R		Het
Olfr713	A	G	7: 107,036,682	N176D	probably benign	Het
Olfr772	A	T	10: 129,174,846	Y58*	probably null	Het
Pcnt	G	A	10: 76,382,174	T2089I	probably benign	Het
Pdzd7	T	C	19: 45,033,073	D563G	probably damaging	Het
Phlpp1	T	G	1: 106,350,603	L915R	probably damaging	Het
Plekhh2	T	A	17: 84,521,803	I34N	probably damaging	Het
Pou6f2	T	A	13: 18,378,498	T84S		Het
Ptprq	A	G	10: 107,586,695	V1612A	possibly damaging	Het
Pvrig	T	G	5: 138,342,148		probably benign	Het
Rasl10b	A	T	11: 83,412,676	I20F	probably damaging	Het
Rimbp3	T	A	16: 17,209,006	V98E	probably damaging	Het
Rims2	T	C	15: 39,437,362	I355T	possibly damaging	Het
Slc1a2	A	G	2: 102,736,015	H30R	probably benign	Het
Slc28a1	G	A	7: 81,161,046	V389M	possibly damaging	Het
Slc7a13	T	C	4: 19,819,189	S130P	probably benign	Het
Sp140	TTTTTTTT	TTTTTTTTTTTTT	1: 85,644,574		probably benign	Het
Spag17	T	A	3: 100,125,435	H2320Q	possibly damaging	Het
Speer4a	T	C	5: 26,036,795	E111G	possibly damaging	Het
Ss18l1	T	C	2: 180,067,338	Y397H	unknown	Het
Tbck	T	C	3: 132,838,057	S890P	probably damaging	Het
Tcp11	T	C	17: 28,080,230	E17G	probably benign	Het
Tesk2	C	T	4: 116,802,287	R315C	probably benign	Het
Tln1	T	C	4: 43,556,383	N45S	probably benign	Het
Vmac	C	A	17: 56,715,573	G146C	probably damaging	Het
Vmn1r14	G	A	6: 57,234,032	M198I	probably damaging	Het
Vmn1r194	T	C	13: 22,244,836	Y208H	possibly damaging	Het
Vmn1r78	G	A	7: 12,153,191	C243Y	probably damaging	Het
Wasf3	C	T	5: 146,466,862	Q261*	probably null	Het
Ybx2	A	G	11: 69,936,237	K88R	probably benign	Het
Zfhx4	G	A	3: 5,398,889	R1394H	probably damaging	Het
Zfp871	T	C	17: 32,774,927	T425A	probably benign	Het
Zfy2	C	T	Y: 2,106,600	S678N	possibly damaging	Het
Zswim4	T	C	8: 84,223,316	E650G	possibly damaging	Het

Other mutations in Trim10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Trim10	APN	17	36877248	missense	probably benign	0.03
IGL00501:Trim10	APN	17	36877047	missense	probably benign	0.08
IGL00846:Trim10	APN	17	36871692	missense	probably damaging	1.00
IGL01536:Trim10	APN	17	36877288	splice site	probably null
IGL02814:Trim10	APN	17	36877336	nonsense	probably null
IGL03135:Trim10	APN	17	36874221	missense	possibly damaging	0.78
IGL03144:Trim10	APN	17	36876848	missense	probably damaging	1.00
IGL03298:Trim10	APN	17	36877025	missense	possibly damaging	0.87
PIT4378001:Trim10	UTSW	17	36877128	missense	probably damaging	0.98
R0102:Trim10	UTSW	17	36870182	missense	probably damaging	1.00
R0102:Trim10	UTSW	17	36870182	missense	probably damaging	1.00
R0834:Trim10	UTSW	17	36872391	missense	probably benign	0.00
R1517:Trim10	UTSW	17	36872454	missense	probably damaging	1.00
R1691:Trim10	UTSW	17	36876899	missense	probably damaging	1.00
R1696:Trim10	UTSW	17	36877181	nonsense	probably null
R2149:Trim10	UTSW	17	36877014	missense	probably benign	0.18
R3153:Trim10	UTSW	17	36871688	missense	probably damaging	1.00
R3154:Trim10	UTSW	17	36871688	missense	probably damaging	1.00
R5156:Trim10	UTSW	17	36877056	missense	probably damaging	0.99
R5327:Trim10	UTSW	17	36870189	missense	probably damaging	1.00
R5361:Trim10	UTSW	17	36875436	missense	probably benign	0.03
R5758:Trim10	UTSW	17	36877152	missense	possibly damaging	0.80
R5764:Trim10	UTSW	17	36870181	missense	probably damaging	0.97
R6032:Trim10	UTSW	17	36871714	missense	possibly damaging	0.87
R6032:Trim10	UTSW	17	36871714	missense	possibly damaging	0.87
R6179:Trim10	UTSW	17	36877031	missense	probably damaging	1.00
R6709:Trim10	UTSW	17	36872370	missense	probably damaging	0.99
R7172:Trim10	UTSW	17	36870063	missense	possibly damaging	0.78
R7197:Trim10	UTSW	17	36876954	missense	probably damaging	1.00
R7390:Trim10	UTSW	17	36869881	start codon destroyed	probably null	0.98
R7391:Trim10	UTSW	17	36869881	start codon destroyed	probably null	0.98
R7696:Trim10	UTSW	17	36871752	missense	probably damaging	1.00
R8867:Trim10	UTSW	17	36870156	missense	probably benign	0.00
R8970:Trim10	UTSW	17	36873276	missense	probably benign	0.00
R9376:Trim10	UTSW	17	36873276	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTATGGTGCTTTGAGCCCC -3'
(R):5'- TTCTCCACCACATTGGCCAG -3'

Sequencing Primer
(F):5'- CCAGAGATGTAACTGGGTCCCTTG -3'
(R):5'- ATTCTGGACCTGGGATCT -3'

Posted On

2021-07-15