Incidental Mutation 'R8830:Gldc'
ID 673788
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms D030049L12Rik, D19Wsu57e
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8830 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30098449-30175418 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 30100812 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 928 (M928I)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably benign
Transcript: ENSMUST00000025778
AA Change: M928I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: M928I

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Meta Mutation Damage Score 0.1865 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
BC017643 C T 11: 121,228,723 probably benign Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
R8887:Gldc UTSW 19 30133756 missense possibly damaging 0.94
R8935:Gldc UTSW 19 30131693 missense probably benign 0.00
R8940:Gldc UTSW 19 30151484 missense probably benign
R9070:Gldc UTSW 19 30103004 missense probably damaging 1.00
R9100:Gldc UTSW 19 30099914 missense possibly damaging 0.81
R9144:Gldc UTSW 19 30137193 missense
R9163:Gldc UTSW 19 30134286 missense probably benign 0.13
R9429:Gldc UTSW 19 30113772 missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GCCATTCGAGATTGAAACCTCTG -3'
(R):5'- CCTGCTACTACATAGACGTACC -3'

Sequencing Primer
(F):5'- CGAGATTGAAACCTCTGTGTTTC -3'
(R):5'- TGCTTGTAAAAGCCATGCTAC -3'
Posted On 2021-07-15