Incidental Mutation 'R0729:Blvrb'
ID67383
Institutional Source Beutler Lab
Gene Symbol Blvrb
Ensembl Gene ENSMUSG00000040466
Gene Namebiliverdin reductase B (flavin reductase (NADPH))
Synonyms
MMRRC Submission 038910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0729 (G1)
Quality Score194
Status Validated
Chromosome7
Chromosomal Location27447978-27466144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27448130 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 5 (K5E)
Ref Sequence ENSEMBL: ENSMUSP00000103995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000037399] [ENSMUST00000108357] [ENSMUST00000108358] [ENSMUST00000133750] [ENSMUST00000152572] [ENSMUST00000172269]
Predicted Effect probably benign
Transcript: ENSMUST00000011895
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000037399
AA Change: K5E

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043092
Gene: ENSMUSG00000040466
AA Change: K5E

DomainStartEndE-ValueType
Pfam:Epimerase 6 155 9.1e-9 PFAM
Pfam:NAD_binding_10 6 191 6e-33 PFAM
Pfam:NmrA 6 205 5.8e-12 PFAM
Pfam:3Beta_HSD 7 122 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108357
SMART Domains Protein: ENSMUSP00000103994
Gene: ENSMUSG00000040466

DomainStartEndE-ValueType
Pfam:NAD_binding_10 2 105 1.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108358
AA Change: K5E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103995
Gene: ENSMUSG00000040466
AA Change: K5E

DomainStartEndE-ValueType
Pfam:NmrA 6 84 1.1e-8 PFAM
low complexity region 85 119 N/A INTRINSIC
SCOP:d1hdoa_ 150 246 9e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133750
AA Change: K5E

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137414
Predicted Effect probably benign
Transcript: ENSMUST00000152572
SMART Domains Protein: ENSMUSP00000120738
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 58 64 N/A INTRINSIC
Pfam:CH 84 128 7.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153644
Predicted Effect probably benign
Transcript: ENSMUST00000172269
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207799
Meta Mutation Damage Score 0.1898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The final step in heme metabolism in mammals is catalyzed by the cytosolic biliverdin reductase enzymes A and B (EC 1.3.1.24).[supplied by OMIM, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,159,455 A828S probably benign Het
Acsm3 T C 7: 119,783,984 probably benign Het
Adamts12 G A 15: 11,255,683 R446H possibly damaging Het
Adgrb1 A G 15: 74,548,549 N849S probably damaging Het
Ankra2 A G 13: 98,271,727 D228G probably damaging Het
Bicd1 T C 6: 149,512,914 V375A probably damaging Het
Cacna2d2 A G 9: 107,517,257 N573D probably benign Het
Calhm2 C A 19: 47,132,917 G271V possibly damaging Het
Capn13 C T 17: 73,322,069 G581E probably damaging Het
Capzb T C 4: 139,288,977 probably benign Het
Casd1 T C 6: 4,619,753 probably benign Het
Clca4b A G 3: 144,928,350 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crx A G 7: 15,871,133 probably benign Het
Cyp2c68 T C 19: 39,739,550 probably benign Het
Dcaf8 T A 1: 172,172,654 D126E probably benign Het
Ddx31 T C 2: 28,874,174 I464T probably damaging Het
Dhx32 G A 7: 133,737,421 T155I probably benign Het
Elac2 C A 11: 64,998,523 P567T possibly damaging Het
Fat4 A G 3: 39,000,295 probably benign Het
Fh1 T G 1: 175,614,817 N156H probably damaging Het
Gm10064 T C 5: 122,697,521 noncoding transcript Het
Gm14137 A G 2: 119,175,353 E131G probably benign Het
Gpr22 T A 12: 31,709,313 K233M probably damaging Het
Gpr63 A G 4: 25,007,480 N68S probably benign Het
Gypa C T 8: 80,496,792 P66S unknown Het
Htr2a A T 14: 74,642,147 Q72L probably benign Het
Klhdc7b C T 15: 89,387,395 R827* probably null Het
Leo1 G A 9: 75,457,138 R520Q possibly damaging Het
Lrrc66 T C 5: 73,608,414 M429V probably benign Het
Lrrc74a C T 12: 86,745,579 Q225* probably null Het
Mamdc4 T A 2: 25,570,036 N68Y probably damaging Het
Map3k10 G A 7: 27,661,567 P507L probably damaging Het
Methig1 T A 15: 100,374,989 C68S probably benign Het
Metrn C T 17: 25,796,228 probably benign Het
Mmp12 C T 9: 7,358,290 T392I possibly damaging Het
Mss51 A T 14: 20,483,092 I437N probably damaging Het
Mtus2 A G 5: 148,077,287 T297A probably benign Het
Myo10 T C 15: 25,722,157 probably benign Het
Ncoa7 G A 10: 30,691,579 P319S probably benign Het
Nlrp4d A T 7: 10,377,685 probably benign Het
Obscn A G 11: 59,032,709 S6455P probably damaging Het
Olfr1447 T C 19: 12,900,895 N295S probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Pcdh12 A G 18: 38,282,464 I536T probably benign Het
Pex5l G T 3: 32,954,536 probably benign Het
Pla2g2e A C 4: 138,880,735 K43Q possibly damaging Het
Rasa4 T C 5: 136,102,070 probably benign Het
Rsf1 C T 7: 97,679,027 R1079W probably damaging Het
Sez6 A G 11: 77,976,585 T803A probably benign Het
Shcbp1 T A 8: 4,736,297 N602Y probably benign Het
Slc16a13 G A 11: 70,219,031 P215S probably damaging Het
Slc39a6 T C 18: 24,601,470 Q54R probably benign Het
Smg1 C A 7: 118,146,289 probably benign Het
Spg7 A G 8: 123,070,417 N110D probably damaging Het
Sptbn1 A T 11: 30,110,902 S2010T probably damaging Het
Sun1 T A 5: 139,237,864 probably benign Het
Sytl5 A G X: 9,994,497 E717G probably damaging Het
Tle1 A T 4: 72,126,442 probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Tmem63b A G 17: 45,674,134 S179P probably damaging Het
Trpm3 T A 19: 22,987,789 F1549L probably benign Het
Ubr4 A T 4: 139,485,320 Y5063F possibly damaging Het
Uroc1 T A 6: 90,336,955 Y75N probably damaging Het
Vmn2r70 T C 7: 85,565,904 T141A probably benign Het
Vps13c A G 9: 67,961,649 K3128E probably damaging Het
Wdr26 T C 1: 181,185,905 probably null Het
Wrn T A 8: 33,248,918 probably null Het
Zfp106 C T 2: 120,555,248 V13M probably damaging Het
Zfp456 G A 13: 67,366,544 H348Y probably damaging Het
Zfpm1 G A 8: 122,336,659 R819H probably benign Het
Other mutations in Blvrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02452:Blvrb APN 7 27459340 missense possibly damaging 0.95
R2364:Blvrb UTSW 7 27448133 missense possibly damaging 0.68
R2377:Blvrb UTSW 7 27459599 missense probably damaging 1.00
R5021:Blvrb UTSW 7 27448118 start codon destroyed probably benign 0.11
R5374:Blvrb UTSW 7 27465846 missense possibly damaging 0.86
R5607:Blvrb UTSW 7 27459469 missense probably benign 0.01
R5608:Blvrb UTSW 7 27459469 missense probably benign 0.01
R6026:Blvrb UTSW 7 27462690 missense probably damaging 1.00
R6122:Blvrb UTSW 7 27459348 missense possibly damaging 0.90
R6523:Blvrb UTSW 7 27465717 splice site probably null
R7605:Blvrb UTSW 7 27465793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATGCAATTTGACTCCTCCGCC -3'
(R):5'- AATGTCAGAGTCCTCCATTTGTGCC -3'

Sequencing Primer
(F):5'- ATGCTCTTTCCAGCGGG -3'
(R):5'- CCCGTGACCACTTGCTG -3'
Posted On2013-09-03