Incidental Mutation 'R0729:Map3k10'
ID67384
Institutional Source Beutler Lab
Gene Symbol Map3k10
Ensembl Gene ENSMUSG00000040390
Gene Namemitogen-activated protein kinase kinase kinase 10
SynonymsMlk2, serine/threonine kinase, MKN28 derived nonreceptor_type, mixed lineage kinase 2, MKN28 kinase
MMRRC Submission 038910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0729 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27656375-27674598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27661567 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 507 (P507L)
Ref Sequence ENSEMBL: ENSMUSP00000037725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008088] [ENSMUST00000036453] [ENSMUST00000108341]
Predicted Effect probably benign
Transcript: ENSMUST00000008088
SMART Domains Protein: ENSMUSP00000008088
Gene: ENSMUSG00000007944

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
low complexity region 49 65 N/A INTRINSIC
Blast:TPR 66 95 2e-7 BLAST
low complexity region 101 117 N/A INTRINSIC
Blast:TPR 133 168 1e-10 BLAST
Pfam:TPR_2 169 202 3.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036453
AA Change: P507L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037725
Gene: ENSMUSG00000040390
AA Change: P507L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase 98 357 7.4e-59 PFAM
Pfam:Pkinase_Tyr 98 357 3.8e-62 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108341
AA Change: P507L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103978
Gene: ENSMUSG00000040390
AA Change: P507L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase_Tyr 98 357 2e-62 PFAM
Pfam:Pkinase 98 358 4.8e-59 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152032
Meta Mutation Damage Score 0.594 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase has been shown to activate MAPK8/JNK and MKK4/SEK1, and this kinase itself can be phoshorylated, and thus activated by JNK kinases. This kinase functions preferentially on the JNK signaling pathway, and is reported to be involved in nerve growth factor (NGF) induced neuronal apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,159,455 A828S probably benign Het
Acsm3 T C 7: 119,783,984 probably benign Het
Adamts12 G A 15: 11,255,683 R446H possibly damaging Het
Adgrb1 A G 15: 74,548,549 N849S probably damaging Het
Ankra2 A G 13: 98,271,727 D228G probably damaging Het
Bicd1 T C 6: 149,512,914 V375A probably damaging Het
Blvrb A G 7: 27,448,130 K5E possibly damaging Het
Cacna2d2 A G 9: 107,517,257 N573D probably benign Het
Calhm2 C A 19: 47,132,917 G271V possibly damaging Het
Capn13 C T 17: 73,322,069 G581E probably damaging Het
Capzb T C 4: 139,288,977 probably benign Het
Casd1 T C 6: 4,619,753 probably benign Het
Clca4b A G 3: 144,928,350 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crx A G 7: 15,871,133 probably benign Het
Cyp2c68 T C 19: 39,739,550 probably benign Het
Dcaf8 T A 1: 172,172,654 D126E probably benign Het
Ddx31 T C 2: 28,874,174 I464T probably damaging Het
Dhx32 G A 7: 133,737,421 T155I probably benign Het
Elac2 C A 11: 64,998,523 P567T possibly damaging Het
Fat4 A G 3: 39,000,295 probably benign Het
Fh1 T G 1: 175,614,817 N156H probably damaging Het
Gm10064 T C 5: 122,697,521 noncoding transcript Het
Gm14137 A G 2: 119,175,353 E131G probably benign Het
Gpr22 T A 12: 31,709,313 K233M probably damaging Het
Gpr63 A G 4: 25,007,480 N68S probably benign Het
Gypa C T 8: 80,496,792 P66S unknown Het
Htr2a A T 14: 74,642,147 Q72L probably benign Het
Klhdc7b C T 15: 89,387,395 R827* probably null Het
Leo1 G A 9: 75,457,138 R520Q possibly damaging Het
Lrrc66 T C 5: 73,608,414 M429V probably benign Het
Lrrc74a C T 12: 86,745,579 Q225* probably null Het
Mamdc4 T A 2: 25,570,036 N68Y probably damaging Het
Methig1 T A 15: 100,374,989 C68S probably benign Het
Metrn C T 17: 25,796,228 probably benign Het
Mmp12 C T 9: 7,358,290 T392I possibly damaging Het
Mss51 A T 14: 20,483,092 I437N probably damaging Het
Mtus2 A G 5: 148,077,287 T297A probably benign Het
Myo10 T C 15: 25,722,157 probably benign Het
Ncoa7 G A 10: 30,691,579 P319S probably benign Het
Nlrp4d A T 7: 10,377,685 probably benign Het
Obscn A G 11: 59,032,709 S6455P probably damaging Het
Olfr1447 T C 19: 12,900,895 N295S probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Pcdh12 A G 18: 38,282,464 I536T probably benign Het
Pex5l G T 3: 32,954,536 probably benign Het
Pla2g2e A C 4: 138,880,735 K43Q possibly damaging Het
Rasa4 T C 5: 136,102,070 probably benign Het
Rsf1 C T 7: 97,679,027 R1079W probably damaging Het
Sez6 A G 11: 77,976,585 T803A probably benign Het
Shcbp1 T A 8: 4,736,297 N602Y probably benign Het
Slc16a13 G A 11: 70,219,031 P215S probably damaging Het
Slc39a6 T C 18: 24,601,470 Q54R probably benign Het
Smg1 C A 7: 118,146,289 probably benign Het
Spg7 A G 8: 123,070,417 N110D probably damaging Het
Sptbn1 A T 11: 30,110,902 S2010T probably damaging Het
Sun1 T A 5: 139,237,864 probably benign Het
Sytl5 A G X: 9,994,497 E717G probably damaging Het
Tle1 A T 4: 72,126,442 probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Tmem63b A G 17: 45,674,134 S179P probably damaging Het
Trpm3 T A 19: 22,987,789 F1549L probably benign Het
Ubr4 A T 4: 139,485,320 Y5063F possibly damaging Het
Uroc1 T A 6: 90,336,955 Y75N probably damaging Het
Vmn2r70 T C 7: 85,565,904 T141A probably benign Het
Vps13c A G 9: 67,961,649 K3128E probably damaging Het
Wdr26 T C 1: 181,185,905 probably null Het
Wrn T A 8: 33,248,918 probably null Het
Zfp106 C T 2: 120,555,248 V13M probably damaging Het
Zfp456 G A 13: 67,366,544 H348Y probably damaging Het
Zfpm1 G A 8: 122,336,659 R819H probably benign Het
Other mutations in Map3k10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Map3k10 APN 7 27668469 missense probably damaging 1.00
IGL00672:Map3k10 APN 7 27661601 missense probably damaging 0.98
IGL00913:Map3k10 APN 7 27663215 unclassified probably benign
IGL01383:Map3k10 APN 7 27657999 missense probably benign 0.15
IGL02683:Map3k10 APN 7 27658937 missense probably damaging 1.00
R0039:Map3k10 UTSW 7 27658098 missense possibly damaging 0.95
R0219:Map3k10 UTSW 7 27656731 missense probably damaging 1.00
R0285:Map3k10 UTSW 7 27673900 missense probably benign 0.00
R0368:Map3k10 UTSW 7 27663360 missense probably damaging 0.98
R0724:Map3k10 UTSW 7 27668355 missense probably damaging 1.00
R1734:Map3k10 UTSW 7 27658115 missense probably damaging 1.00
R1847:Map3k10 UTSW 7 27661556 unclassified probably null
R2395:Map3k10 UTSW 7 27673993 missense unknown
R2517:Map3k10 UTSW 7 27663263 missense possibly damaging 0.92
R3841:Map3k10 UTSW 7 27658364 missense possibly damaging 0.91
R4749:Map3k10 UTSW 7 27658361 missense possibly damaging 0.78
R5269:Map3k10 UTSW 7 27658532 missense probably benign 0.01
R5822:Map3k10 UTSW 7 27656734 missense probably damaging 1.00
R6059:Map3k10 UTSW 7 27656822 missense probably damaging 0.99
R6417:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R6420:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
X0020:Map3k10 UTSW 7 27664462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTTGCAGAATGGACCATACAC -3'
(R):5'- TGCATGAAGCACTGACCGCTAC -3'

Sequencing Primer
(F):5'- tgaaccctgtgaccaaacc -3'
(R):5'- ACTGACCGCTACTGCCATC -3'
Posted On2013-09-03