Incidental Mutation 'R8831:Kdm1b'
ID 673855
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Name lysine (K)-specific demethylase 1B
Synonyms 4632428N09Rik, Aof1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock # R8831 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 47043499-47085279 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 47064141 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 359 (L359I)
Ref Sequence ENSEMBL: ENSMUSP00000038373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037025]
AlphaFold Q8CIG3
Predicted Effect possibly damaging
Transcript: ENSMUST00000037025
AA Change: L359I

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080
AA Change: L359I

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143518
AA Change: L75I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080
AA Change: L75I

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,182,136 I320T probably benign Het
5430403G16Rik A T 5: 109,676,308 S425R probably benign Het
A230072I06Rik A T 8: 12,279,688 I48L unknown Het
Abcc3 A C 11: 94,350,961 C1415G probably damaging Het
Abcf3 C T 16: 20,550,464 R205C probably damaging Het
Abcg5 G T 17: 84,668,995 H471Q probably damaging Het
Actl6b G A 5: 137,567,043 R363Q probably damaging Het
Adcy1 T A 11: 7,161,362 D884E probably benign Het
Aldh3a1 A G 11: 61,216,316 Y282C probably damaging Het
Amdhd2 A G 17: 24,157,738 probably null Het
Arfgef3 A G 10: 18,652,743 S299P possibly damaging Het
Asic2 A T 11: 81,967,900 N95K probably damaging Het
Atp2c2 A G 8: 119,749,294 probably null Het
Atrn T C 2: 130,906,601 L14P probably benign Het
BC027072 A T 17: 71,752,310 V124E probably benign Het
C8b A G 4: 104,790,677 Y355C probably damaging Het
Carm1 A G 9: 21,580,367 E244G probably damaging Het
Cd300c2 A T 11: 115,001,018 C39* probably null Het
Cish T A 9: 107,300,472 F116I probably damaging Het
Clstn1 G A 4: 149,646,323 R837Q probably benign Het
Cox10 A G 11: 63,964,480 F325S probably damaging Het
Ctps A T 4: 120,567,310 S36T possibly damaging Het
Dchs2 T C 3: 83,285,363 L1705P probably benign Het
Defb25 C A 2: 152,622,979 V17L probably benign Het
Dhx16 A G 17: 35,888,108 D782G probably damaging Het
Dhx30 A G 9: 110,088,251 S399P probably benign Het
Dhx58 T A 11: 100,703,980 K30M probably damaging Het
Drc7 G A 8: 95,062,217 R301Q probably damaging Het
Dsg1a T C 18: 20,320,308 V21A probably damaging Het
Ercc6 T A 14: 32,560,827 probably null Het
Fam193a A G 5: 34,459,030 T850A probably benign Het
Fgf10 A G 13: 118,789,135 D150G probably damaging Het
Flii A T 11: 60,725,248 N28K probably benign Het
Gfi1 G A 5: 107,720,272 R377C probably damaging Het
Gfra2 A T 14: 70,967,063 N324I probably benign Het
Gm10308 A G 17: 91,089,003 R118G unknown Het
Gm10801 T A 2: 98,663,989 V137E probably damaging Het
Gm4450 A T 3: 98,446,731 W151R probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ift80 G A 3: 68,962,250 A236V probably damaging Het
Il1rn A T 2: 24,349,493 T134S possibly damaging Het
Il6st G T 13: 112,504,380 D897Y probably damaging Het
Imp4 T C 1: 34,444,364 M257T probably benign Het
Impdh2 T C 9: 108,564,758 L377S probably damaging Het
Kidins220 A T 12: 25,036,455 I963L possibly damaging Het
Mdm4 T C 1: 133,003,863 R148G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ncor1 A T 11: 62,369,408 D505E probably benign Het
Necab3 A T 2: 154,554,687 L107Q probably damaging Het
Nkx2-4 G A 2: 147,085,194 P51L probably benign Het
Nol11 T C 11: 107,176,836 T388A probably benign Het
Npc1 T A 18: 12,200,820 M735L probably benign Het
Nr1h3 C A 2: 91,190,746 R232L probably benign Het
Nrcam T A 12: 44,544,897 probably null Het
Olfr341 G A 2: 36,479,782 T116I possibly damaging Het
Olfr591 T A 7: 103,172,996 I214L probably benign Het
Pabpn1 T C 14: 54,894,457 V101A probably damaging Het
Pcbp2 A G 15: 102,486,018 D217G probably benign Het
Pcdhb12 A G 18: 37,437,333 M511V probably benign Het
Phf3 T A 1: 30,821,266 K828* probably null Het
Plcg1 G C 2: 160,747,812 K85N probably benign Het
Prag1 A T 8: 36,146,737 T1148S probably benign Het
Prmt3 A G 7: 49,828,981 E430G probably null Het
Prx G T 7: 27,518,113 V819F probably damaging Het
Ptpn18 A T 1: 34,472,190 R338W probably null Het
Rab6a T C 7: 100,634,724 Y128H probably benign Het
Rgs2 T C 1: 144,001,759 Y186C probably damaging Het
Rhbdl1 C T 17: 25,834,883 V342M probably damaging Het
Rpn1 A G 6: 88,084,793 Q88R probably benign Het
Slc19a2 C T 1: 164,256,874 T111M probably damaging Het
Slc35e4 G A 11: 3,913,087 P34L possibly damaging Het
Slc7a6os A T 8: 106,210,557 D90E probably benign Het
Ssh3 A G 19: 4,269,025 V19A possibly damaging Het
Susd1 C T 4: 59,379,594 probably benign Het
Tcf19 A T 17: 35,514,897 M121K possibly damaging Het
Tcp11 G A 17: 28,080,219 R21C probably damaging Het
Tcp11l2 A G 10: 84,613,658 I496V probably damaging Het
Tenm3 C T 8: 48,276,382 A1530T Het
Tmem127 T A 2: 127,257,059 V171D probably damaging Het
Tyrp1 G A 4: 80,835,162 C30Y probably damaging Het
Usp48 A T 4: 137,613,769 D360V probably damaging Het
Vamp4 T A 1: 162,574,383 D11E possibly damaging Het
Vmn1r14 T C 6: 57,233,520 F28L probably benign Het
Vmn2r69 G T 7: 85,409,810 C514* probably null Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Zhx3 T A 2: 160,780,771 Y492F probably benign Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47068540 missense probably benign 0.01
IGL00924:Kdm1b APN 13 47068480 missense probably benign
IGL01553:Kdm1b APN 13 47080548 missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47073737 missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47068506 missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47060855 missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47080467 missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47049266 missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47064117 missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47053719 missense probably benign
R0426:Kdm1b UTSW 13 47064244 splice site probably benign
R0599:Kdm1b UTSW 13 47058810 missense possibly damaging 0.47
R0764:Kdm1b UTSW 13 47068603 missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47071922 missense probably benign 0.02
R1543:Kdm1b UTSW 13 47068521 missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47064054 missense probably damaging 1.00
R1627:Kdm1b UTSW 13 47064231 critical splice donor site probably null
R1669:Kdm1b UTSW 13 47068548 missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47060768 missense probably benign 0.00
R1860:Kdm1b UTSW 13 47049190 missense probably benign 0.03
R1907:Kdm1b UTSW 13 47064120 missense probably benign 0.00
R2225:Kdm1b UTSW 13 47064088 frame shift probably null
R2239:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47064088 frame shift probably null
R2302:Kdm1b UTSW 13 47064088 frame shift probably null
R2303:Kdm1b UTSW 13 47064088 frame shift probably null
R2380:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47062975 missense probably benign 0.32
R3022:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47063020 missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47060893 missense probably benign
R4906:Kdm1b UTSW 13 47063144 critical splice donor site probably null
R4965:Kdm1b UTSW 13 47074367 missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47077486 missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47062991 missense probably damaging 1.00
R5265:Kdm1b UTSW 13 47062969 missense probably benign 0.35
R5541:Kdm1b UTSW 13 47079196 missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47063146 splice site probably null
R6046:Kdm1b UTSW 13 47079253 missense possibly damaging 0.92
R6798:Kdm1b UTSW 13 47068536 missense probably benign 0.00
R6903:Kdm1b UTSW 13 47074404 missense probably benign 0.00
R7831:Kdm1b UTSW 13 47050622 missense probably benign 0.17
R7973:Kdm1b UTSW 13 47077446 missense probably benign 0.00
R8181:Kdm1b UTSW 13 47051901 critical splice donor site probably null
R8248:Kdm1b UTSW 13 47071878 intron probably benign
R8821:Kdm1b UTSW 13 47064141 missense possibly damaging 0.94
R8842:Kdm1b UTSW 13 47078356 missense probably damaging 1.00
R8861:Kdm1b UTSW 13 47064106 missense probably benign 0.02
R8885:Kdm1b UTSW 13 47053708 nonsense probably null
R9038:Kdm1b UTSW 13 47049294 missense probably benign 0.07
R9132:Kdm1b UTSW 13 47071982 missense probably benign 0.05
R9268:Kdm1b UTSW 13 47064229 missense probably benign 0.00
R9616:Kdm1b UTSW 13 47080554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTAACTAGTTTGAGTGCTGGG -3'
(R):5'- CTGCAGTATCTGGTACCAGTATAG -3'

Sequencing Primer
(F):5'- TCCAGCCACATATGTAGCAGAGG -3'
(R):5'- GTATCTGGTACCAGTATAGCAACAC -3'
Posted On 2021-07-15