Incidental Mutation 'R8831:BC027072'
ID673869
Institutional Source Beutler Lab
Gene Symbol BC027072
Ensembl Gene ENSMUSG00000044375
Gene NamecDNA sequence BC027072
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R8831 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71743557-71752885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71752310 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 124 (V124E)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
Predicted Effect probably benign
Transcript: ENSMUST00000057405
AA Change: V124E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: V124E

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,182,136 I320T probably benign Het
5430403G16Rik A T 5: 109,676,308 S425R probably benign Het
A230072I06Rik A T 8: 12,279,688 I48L unknown Het
Abcc3 A C 11: 94,350,961 C1415G probably damaging Het
Abcf3 C T 16: 20,550,464 R205C probably damaging Het
Abcg5 G T 17: 84,668,995 H471Q probably damaging Het
Actl6b G A 5: 137,567,043 R363Q probably damaging Het
Adcy1 T A 11: 7,161,362 D884E probably benign Het
Aldh3a1 A G 11: 61,216,316 Y282C probably damaging Het
Amdhd2 A G 17: 24,157,738 probably null Het
Arfgef3 A G 10: 18,652,743 S299P possibly damaging Het
Asic2 A T 11: 81,967,900 N95K probably damaging Het
Atp2c2 A G 8: 119,749,294 probably null Het
Atrn T C 2: 130,906,601 L14P probably benign Het
C8b A G 4: 104,790,677 Y355C probably damaging Het
Carm1 A G 9: 21,580,367 E244G probably damaging Het
Cish T A 9: 107,300,472 F116I probably damaging Het
Clstn1 G A 4: 149,646,323 R837Q probably benign Het
Cox10 A G 11: 63,964,480 F325S probably damaging Het
Ctps A T 4: 120,567,310 S36T possibly damaging Het
Dchs2 T C 3: 83,285,363 L1705P probably benign Het
Defb25 C A 2: 152,622,979 V17L probably benign Het
Dhx16 A G 17: 35,888,108 D782G probably damaging Het
Dhx30 A G 9: 110,088,251 S399P probably benign Het
Dhx58 T A 11: 100,703,980 K30M probably damaging Het
Drc7 G A 8: 95,062,217 R301Q probably damaging Het
Dsg1a T C 18: 20,320,308 V21A probably damaging Het
Ercc6 T A 14: 32,560,827 probably null Het
Fam193a A G 5: 34,459,030 T850A probably benign Het
Fgf10 A G 13: 118,789,135 D150G probably damaging Het
Flii A T 11: 60,725,248 N28K probably benign Het
Gfi1 G A 5: 107,720,272 R377C probably damaging Het
Gfra2 A T 14: 70,967,063 N324I probably benign Het
Gm10308 A G 17: 91,089,003 R118G unknown Het
Gm10801 T A 2: 98,663,989 V137E probably damaging Het
Gm4450 A T 3: 98,446,731 W151R probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ift80 G A 3: 68,962,250 A236V probably damaging Het
Il1rn A T 2: 24,349,493 T134S possibly damaging Het
Il6st G T 13: 112,504,380 D897Y probably damaging Het
Imp4 T C 1: 34,444,364 M257T probably benign Het
Impdh2 T C 9: 108,564,758 L377S probably damaging Het
Kdm1b C A 13: 47,064,141 L359I possibly damaging Het
Kidins220 A T 12: 25,036,455 I963L possibly damaging Het
Mdm4 T C 1: 133,003,863 R148G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ncor1 A T 11: 62,369,408 D505E probably benign Het
Necab3 A T 2: 154,554,687 L107Q probably damaging Het
Nkx2-4 G A 2: 147,085,194 P51L probably benign Het
Nol11 T C 11: 107,176,836 T388A probably benign Het
Npc1 T A 18: 12,200,820 M735L probably benign Het
Nr1h3 C A 2: 91,190,746 R232L probably benign Het
Nrcam T A 12: 44,544,897 probably null Het
Olfr341 G A 2: 36,479,782 T116I possibly damaging Het
Olfr591 T A 7: 103,172,996 I214L probably benign Het
Pabpn1 T C 14: 54,894,457 V101A probably damaging Het
Pcbp2 A G 15: 102,486,018 D217G probably benign Het
Pcdhb12 A G 18: 37,437,333 M511V probably benign Het
Phf3 T A 1: 30,821,266 K828* probably null Het
Plcg1 G C 2: 160,747,812 K85N probably benign Het
Prag1 A T 8: 36,146,737 T1148S probably benign Het
Prmt3 A G 7: 49,828,981 E430G probably null Het
Prx G T 7: 27,518,113 V819F probably damaging Het
Ptpn18 A T 1: 34,472,190 R338W probably null Het
Rab6a T C 7: 100,634,724 Y128H probably benign Het
Rgs2 T C 1: 144,001,759 Y186C probably damaging Het
Rhbdl1 C T 17: 25,834,883 V342M probably damaging Het
Rpn1 A G 6: 88,084,793 Q88R probably benign Het
Slc19a2 C T 1: 164,256,874 T111M probably damaging Het
Slc35e4 G A 11: 3,913,087 P34L possibly damaging Het
Slc7a6os A T 8: 106,210,557 D90E probably benign Het
Ssh3 A G 19: 4,269,025 V19A possibly damaging Het
Tcf19 A T 17: 35,514,897 M121K possibly damaging Het
Tcp11 G A 17: 28,080,219 R21C probably damaging Het
Tcp11l2 A G 10: 84,613,658 I496V probably damaging Het
Tenm3 C T 8: 48,276,382 A1530T Het
Tmem127 T A 2: 127,257,059 V171D probably damaging Het
Tyrp1 G A 4: 80,835,162 C30Y probably damaging Het
Usp48 A T 4: 137,613,769 D360V probably damaging Het
Vamp4 T A 1: 162,574,383 D11E possibly damaging Het
Vmn1r14 T C 6: 57,233,520 F28L probably benign Het
Vmn2r69 G T 7: 85,409,810 C514* probably null Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Zhx3 T A 2: 160,780,771 Y492F probably benign Het
Other mutations in BC027072
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:BC027072 APN 17 71749464 missense probably benign 0.38
IGL02033:BC027072 APN 17 71751081 missense probably damaging 1.00
IGL02711:BC027072 APN 17 71749382 missense probably benign 0.15
IGL03185:BC027072 APN 17 71749337 missense probably damaging 0.98
IGL03242:BC027072 APN 17 71750271 missense probably benign 0.01
R0367:BC027072 UTSW 17 71750476 missense probably damaging 1.00
R0413:BC027072 UTSW 17 71752217 missense probably benign 0.38
R0465:BC027072 UTSW 17 71750160 missense probably benign 0.42
R0535:BC027072 UTSW 17 71752439 missense probably benign 0.01
R0681:BC027072 UTSW 17 71749514 missense probably benign 0.00
R0736:BC027072 UTSW 17 71744664 missense probably benign 0.00
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1530:BC027072 UTSW 17 71749478 missense probably benign 0.01
R1723:BC027072 UTSW 17 71750378 missense probably damaging 1.00
R1941:BC027072 UTSW 17 71752068 missense probably damaging 1.00
R2179:BC027072 UTSW 17 71752526 missense probably damaging 1.00
R2232:BC027072 UTSW 17 71749284 missense probably benign 0.00
R2519:BC027072 UTSW 17 71751647 missense probably damaging 1.00
R2997:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
R3899:BC027072 UTSW 17 71750160 missense probably benign 0.00
R4890:BC027072 UTSW 17 71752311 missense possibly damaging 0.50
R4898:BC027072 UTSW 17 71751071 missense probably damaging 1.00
R5347:BC027072 UTSW 17 71749935 missense probably benign 0.00
R5436:BC027072 UTSW 17 71750842 missense probably damaging 1.00
R5527:BC027072 UTSW 17 71752640 missense probably damaging 1.00
R5556:BC027072 UTSW 17 71752425 missense possibly damaging 0.81
R5625:BC027072 UTSW 17 71751326 missense probably damaging 1.00
R5707:BC027072 UTSW 17 71751572 missense possibly damaging 0.90
R5932:BC027072 UTSW 17 71751753 missense probably damaging 1.00
R6043:BC027072 UTSW 17 71750042 missense probably damaging 1.00
R6314:BC027072 UTSW 17 71752457 missense probably benign 0.04
R6513:BC027072 UTSW 17 71744706 missense probably damaging 1.00
R7575:BC027072 UTSW 17 71750855 missense probably damaging 1.00
R7638:BC027072 UTSW 17 71750885 missense probably damaging 1.00
R7848:BC027072 UTSW 17 71749193 missense probably benign 0.04
R8317:BC027072 UTSW 17 71749202 missense probably benign 0.10
R8530:BC027072 UTSW 17 71752106 missense probably damaging 1.00
R8671:BC027072 UTSW 17 71751377 missense probably benign 0.34
R8854:BC027072 UTSW 17 71749331 missense probably benign
R8941:BC027072 UTSW 17 71752142 missense probably benign 0.06
X0035:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
Z1177:BC027072 UTSW 17 71750403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCACAATGGCTTCGTATCTG -3'
(R):5'- TAGAGGAGACAGTGTCAAGTTCC -3'

Sequencing Primer
(F):5'- CACAATGGCTTCGTATCTGGAAAG -3'
(R):5'- TGTCAAGTTCCAAGAAGCTGC -3'
Posted On2021-07-15