Incidental Mutation 'R8832:Dennd2c'
ID 673888
Institutional Source Beutler Lab
Gene Symbol Dennd2c
Ensembl Gene ENSMUSG00000007379
Gene Name DENN/MADD domain containing 2C
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8832 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 103102604-103169769 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 103152404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172288] [ENSMUST00000173206]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000172288
SMART Domains Protein: ENSMUSP00000127187
Gene: ENSMUSG00000007379

DomainStartEndE-ValueType
uDENN 481 571 1.01e-25 SMART
DENN 578 762 3.36e-77 SMART
dDENN 806 873 1.15e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173206
SMART Domains Protein: ENSMUSP00000134008
Gene: ENSMUSG00000007379

DomainStartEndE-ValueType
uDENN 424 514 1.01e-25 SMART
DENN 521 705 3.36e-77 SMART
dDENN 749 816 1.15e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
9330159F19Rik A T 10: 29,224,345 E238V probably damaging Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Agmat G A 4: 141,747,009 R67H probably benign Het
AI182371 T C 2: 35,095,897 D49G unknown Het
Ak7 A G 12: 105,742,339 N351S possibly damaging Het
Aldh3b1 G T 19: 3,914,025 R426S probably damaging Het
Aldh4a1 A G 4: 139,644,155 D460G probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Arhgap32 C T 9: 32,260,819 P1632S possibly damaging Het
Armh1 A G 4: 117,237,670 F58L probably damaging Het
Baz1b C T 5: 135,217,376 R560W possibly damaging Het
Bbs10 C T 10: 111,300,405 Q460* probably null Het
BC034090 A C 1: 155,226,288 S77A probably damaging Het
Brca2 A G 5: 150,542,146 K1792E possibly damaging Het
Cadps2 A T 6: 23,587,537 L318Q possibly damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Cobll1 A T 2: 65,099,258 S575T probably damaging Het
Col6a4 A G 9: 106,072,154 Y761H probably benign Het
Cyp2j9 G T 4: 96,585,884 H106Q probably benign Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Fmnl2 A G 2: 53,054,572 S188G Het
Ggt1 A T 10: 75,574,339 H35L possibly damaging Het
Gphn A T 12: 78,412,400 silent Het
Hic1 G A 11: 75,166,902 A387V possibly damaging Het
Igf1r T A 7: 68,226,021 F1244I probably damaging Het
Kcnk7 T C 19: 5,704,708 V78A probably damaging Het
Kit A G 5: 75,639,131 N508D probably benign Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Klra4 C T 6: 130,044,056 D259N probably benign Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mast2 C T 4: 116,311,678 probably null Het
Mfsd2a A G 4: 122,949,309 V393A probably benign Het
Myh7b T A 2: 155,633,262 V1858E probably benign Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Myt1l T A 12: 29,920,352 N1145K unknown Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Nos2 A G 11: 78,955,464 probably null Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1116 T A 2: 87,269,399 M206K probably benign Het
Olfr1179 A G 2: 88,402,793 I47T probably damaging Het
Olfr332 T C 11: 58,490,237 I173V possibly damaging Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr968 T C 9: 39,772,590 D70G probably damaging Het
Pclo T C 5: 14,788,450 W1424R Het
Pde8a A G 7: 81,306,750 N299S probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Pld1 T A 3: 28,123,697 W686R Het
Ppp1r3b A T 8: 35,384,265 D86V probably damaging Het
Ppp1r3g C T 13: 35,969,160 R188* probably null Het
Ptbp1 A G 10: 79,863,189 E527G probably damaging Het
Rasef T C 4: 73,780,321 probably benign Het
Rce1 A T 19: 4,625,504 C34S unknown Het
Rnf144a T C 12: 26,320,949 probably benign Het
Rpl7 C T 1: 16,103,261 R88H possibly damaging Het
Rubcnl A T 14: 75,031,919 T6S Het
Samd9l A T 6: 3,374,990 V757D probably damaging Het
Sec22c A G 9: 121,685,572 V221A probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Slc6a15 A T 10: 103,389,318 Y89F probably damaging Het
Smg1 A G 7: 118,139,783 V3466A probably benign Het
Sobp G A 10: 43,160,828 T38I probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srsf5 T A 12: 80,949,504 F151I probably damaging Het
Taf2 A C 15: 55,064,605 L134R possibly damaging Het
Tbc1d1 A G 5: 64,284,677 probably benign Het
Thap1 C T 8: 26,158,233 probably benign Het
Tmc5 A T 7: 118,623,109 M11L probably benign Het
Tnfaip8 ACACACTCTCTCTCTC AC 18: 50,046,841 probably benign Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zdhhc20 A T 14: 57,843,264 S263T possibly damaging Het
Zdhhc20 A G 14: 57,865,632 S87P probably benign Het
Zfp423 C A 8: 87,781,199 C839F probably damaging Het
Other mutations in Dennd2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Dennd2c APN 3 103156908 missense probably damaging 1.00
IGL01791:Dennd2c APN 3 103166425 missense probably benign 0.19
IGL02100:Dennd2c APN 3 103153675 missense probably damaging 0.98
IGL02119:Dennd2c APN 3 103137243 missense probably damaging 0.99
IGL02395:Dennd2c APN 3 103157765 missense probably benign 0.00
IGL02631:Dennd2c APN 3 103156071 missense possibly damaging 0.56
IGL02895:Dennd2c APN 3 103137203 missense possibly damaging 0.76
convolution UTSW 3 103156107 missense probably damaging 1.00
Resolution UTSW 3 103133345 missense possibly damaging 0.51
R1749:Dennd2c UTSW 3 103132036 missense possibly damaging 0.92
R1931:Dennd2c UTSW 3 103133252 missense probably benign 0.32
R1964:Dennd2c UTSW 3 103166491 missense probably damaging 1.00
R1972:Dennd2c UTSW 3 103131698 missense probably benign 0.01
R1973:Dennd2c UTSW 3 103131698 missense probably benign 0.01
R2025:Dennd2c UTSW 3 103131689 missense possibly damaging 0.71
R2350:Dennd2c UTSW 3 103132001 missense probably benign 0.00
R2373:Dennd2c UTSW 3 103156842 missense probably damaging 0.99
R4555:Dennd2c UTSW 3 103131886 missense probably benign 0.00
R4916:Dennd2c UTSW 3 103131824 missense probably benign 0.00
R5560:Dennd2c UTSW 3 103161555 missense probably damaging 1.00
R6291:Dennd2c UTSW 3 103131609 nonsense probably null
R6395:Dennd2c UTSW 3 103149224 critical splice donor site probably null
R6567:Dennd2c UTSW 3 103132019 missense probably benign 0.02
R6681:Dennd2c UTSW 3 103131661 missense probably benign 0.01
R7106:Dennd2c UTSW 3 103131577 missense possibly damaging 0.82
R7162:Dennd2c UTSW 3 103156107 missense probably damaging 1.00
R7514:Dennd2c UTSW 3 103163062 missense probably benign 0.00
R7591:Dennd2c UTSW 3 103133345 missense possibly damaging 0.51
R7698:Dennd2c UTSW 3 103165043 missense possibly damaging 0.65
R8069:Dennd2c UTSW 3 103165130 missense probably damaging 1.00
R8086:Dennd2c UTSW 3 103133345 missense possibly damaging 0.51
R8247:Dennd2c UTSW 3 103152321 missense probably damaging 0.99
R8347:Dennd2c UTSW 3 103157709 missense probably damaging 0.99
R8829:Dennd2c UTSW 3 103152404 critical splice donor site probably null
R9131:Dennd2c UTSW 3 103157715 missense probably damaging 1.00
R9332:Dennd2c UTSW 3 103131561 missense probably benign 0.01
R9350:Dennd2c UTSW 3 103131992 missense possibly damaging 0.79
R9520:Dennd2c UTSW 3 103137168 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGGCTGAGGCTTGTTAG -3'
(R):5'- GACCCATTTTGAAGGATTGGTAAAC -3'

Sequencing Primer
(F):5'- GCTTCTGCTCTCCGTTTTCATAGG -3'
(R):5'- GATTGGTAAACTAAGGGTATTCGC -3'
Posted On 2021-07-15