Incidental Mutation 'R8832:Kit'
ID673901
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R8832 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75639131 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 508 (N508D)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
PDB Structure Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: N508D

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: N508D

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144270
AA Change: N508D

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: N508D

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
9330159F19Rik A T 10: 29,224,345 E238V probably damaging Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Agmat G A 4: 141,747,009 R67H probably benign Het
Ak7 A G 12: 105,742,339 N351S possibly damaging Het
Aldh3b1 G T 19: 3,914,025 R426S probably damaging Het
Aldh4a1 A G 4: 139,644,155 D460G probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Arhgap32 C T 9: 32,260,819 P1632S possibly damaging Het
Armh1 A G 4: 117,237,670 F58L probably damaging Het
Baz1b C T 5: 135,217,376 R560W possibly damaging Het
Bbs10 C T 10: 111,300,405 Q460* probably null Het
BC034090 A C 1: 155,226,288 S77A probably damaging Het
Brca2 A G 5: 150,542,146 K1792E possibly damaging Het
Cadps2 A T 6: 23,587,537 L318Q possibly damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Cobll1 A T 2: 65,099,258 S575T probably damaging Het
Col6a4 A G 9: 106,072,154 Y761H probably benign Het
Cyp2j9 G T 4: 96,585,884 H106Q probably benign Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
Dennd2c T A 3: 103,152,404 probably null Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Fmnl2 A G 2: 53,054,572 S188G Het
Ggt1 A T 10: 75,574,339 H35L possibly damaging Het
Hic1 G A 11: 75,166,902 A387V possibly damaging Het
Igf1r T A 7: 68,226,021 F1244I probably damaging Het
Kcnk7 T C 19: 5,704,708 V78A probably damaging Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Klra4 C T 6: 130,044,056 D259N probably benign Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mast2 C T 4: 116,311,678 probably null Het
Mfsd2a A G 4: 122,949,309 V393A probably benign Het
Myh7b T A 2: 155,633,262 V1858E probably benign Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Myt1l T A 12: 29,920,352 N1145K unknown Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Nos2 A G 11: 78,955,464 probably null Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1116 T A 2: 87,269,399 M206K probably benign Het
Olfr1179 A G 2: 88,402,793 I47T probably damaging Het
Olfr332 T C 11: 58,490,237 I173V possibly damaging Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr968 T C 9: 39,772,590 D70G probably damaging Het
Pclo T C 5: 14,788,450 W1424R Het
Pde8a A G 7: 81,306,750 N299S probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Pld1 T A 3: 28,123,697 W686R Het
Ppp1r3b A T 8: 35,384,265 D86V probably damaging Het
Ppp1r3g C T 13: 35,969,160 R188* probably null Het
Ptbp1 TCTGCTGCTGCTGCTGCTGC TCTGCTGCTGCTGCTGC 10: 79,860,874 probably benign Het
Ptbp1 A G 10: 79,863,189 E527G probably damaging Het
Rce1 A T 19: 4,625,504 C34S unknown Het
Rpl7 C T 1: 16,103,261 R88H possibly damaging Het
Rubcnl A T 14: 75,031,919 T6S Het
Samd9l A T 6: 3,374,990 V757D probably damaging Het
Sec22c A G 9: 121,685,572 V221A probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Slc6a15 A T 10: 103,389,318 Y89F probably damaging Het
Smg1 A G 7: 118,139,783 V3466A probably benign Het
Sobp G A 10: 43,160,828 T38I probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srsf5 T A 12: 80,949,504 F151I probably damaging Het
Taf2 A C 15: 55,064,605 L134R possibly damaging Het
Tmc5 A T 7: 118,623,109 M11L probably benign Het
Tnfaip8 ACACACTCTCTCTCTC AC 18: 50,046,841 probably benign Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zdhhc20 A T 14: 57,843,264 S263T possibly damaging Het
Zdhhc20 A G 14: 57,865,632 S87P probably benign Het
Zfp423 C A 8: 87,781,199 C839F probably damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
casper UTSW 5 75645875 missense probably damaging 1.00
Mooyah2 UTSW 5 75652808 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
slimmer UTSW 5 75640757 missense possibly damaging 0.94
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
R7021:Kit UTSW 5 75620967 missense probably benign 0.00
R7080:Kit UTSW 5 75607281 missense probably damaging 0.99
R7117:Kit UTSW 5 75607098 missense probably benign 0.18
R7156:Kit UTSW 5 75615374 missense probably benign 0.14
R7379:Kit UTSW 5 75647752 missense probably damaging 1.00
R7427:Kit UTSW 5 75645847 missense possibly damaging 0.92
R7438:Kit UTSW 5 75639000 missense probably benign 0.01
R7531:Kit UTSW 5 75607040 missense probably damaging 0.99
R7711:Kit UTSW 5 75637359 missense probably damaging 0.97
R7810:Kit UTSW 5 75609322 missense probably benign 0.11
R7819:Kit UTSW 5 75645932 missense probably benign 0.41
R8021:Kit UTSW 5 75615491 missense possibly damaging 0.79
R8139:Kit UTSW 5 75652805 missense probably damaging 0.99
R8165:Kit UTSW 5 75620880 missense possibly damaging 0.94
R8249:Kit UTSW 5 75641408 missense probably damaging 0.97
R8288:Kit UTSW 5 75654489 missense probably damaging 1.00
R8290:Kit UTSW 5 75641169 missense probably benign
R8829:Kit UTSW 5 75639131 missense probably benign 0.41
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGCAGGCTTCTATTTGGC -3'
(R):5'- CATCAGCAGACTAGTATGGGATGAG -3'

Sequencing Primer
(F):5'- GCAGGCTTCTATTTGGCTTACC -3'
(R):5'- AGACTAGTATGGGATGAGTTTGTGAC -3'
Posted On2021-07-15