Incidental Mutation 'R8832:Cadps2'
ID 673906
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 068660-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8832 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23587536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 318 (L318Q)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000018122
AA Change: L318Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: L318Q

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115356
AA Change: L318Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
AA Change: L318Q

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115361
AA Change: L318Q

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125350
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142913
AA Change: L289Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: L289Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
AA Change: L318Q

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: L289Q

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: L289Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,100,341 (GRCm39) E238V probably damaging Het
Adh6b T C 3: 138,055,463 (GRCm39) V71A probably benign Het
Agmat G A 4: 141,474,320 (GRCm39) R67H probably benign Het
AI182371 T C 2: 34,985,909 (GRCm39) D49G unknown Het
Ak7 A G 12: 105,708,598 (GRCm39) N351S possibly damaging Het
Aldh3b1 G T 19: 3,964,025 (GRCm39) R426S probably damaging Het
Aldh4a1 A G 4: 139,371,466 (GRCm39) D460G probably benign Het
Aox4 A T 1: 58,294,649 (GRCm39) M953L probably benign Het
Arhgap32 C T 9: 32,172,115 (GRCm39) P1632S possibly damaging Het
Armh1 A G 4: 117,094,867 (GRCm39) F58L probably damaging Het
Baz1b C T 5: 135,246,230 (GRCm39) R560W possibly damaging Het
Bbs10 C T 10: 111,136,266 (GRCm39) Q460* probably null Het
BC034090 A C 1: 155,102,034 (GRCm39) S77A probably damaging Het
Bltp2 A G 11: 78,158,064 (GRCm39) K409E probably benign Het
Brca2 A G 5: 150,465,611 (GRCm39) K1792E possibly damaging Het
Catsperg2 A G 7: 29,397,269 (GRCm39) V1078A probably benign Het
Ccno A G 13: 113,126,239 (GRCm39) N236S probably benign Het
Chct1 A G 11: 85,062,037 (GRCm39) D12G probably damaging Het
Cobll1 A T 2: 64,929,602 (GRCm39) S575T probably damaging Het
Col6a4 A G 9: 105,949,353 (GRCm39) Y761H probably benign Het
Cyp2j9 G T 4: 96,474,121 (GRCm39) H106Q probably benign Het
Dennd2c T A 3: 103,059,720 (GRCm39) probably null Het
Drd5 G A 5: 38,477,078 (GRCm39) V24M probably benign Het
Dthd1 T C 5: 62,971,608 (GRCm39) S144P probably benign Het
Fcna C A 2: 25,516,145 (GRCm39) R124L possibly damaging Het
Fmnl2 A G 2: 52,944,584 (GRCm39) S188G Het
Ggt1 A T 10: 75,410,173 (GRCm39) H35L possibly damaging Het
Gphn A T 12: 78,459,174 (GRCm39) silent Het
Hic1 G A 11: 75,057,728 (GRCm39) A387V possibly damaging Het
Hycc2 A T 1: 58,587,832 (GRCm39) I127N possibly damaging Het
Igf1r T A 7: 67,875,769 (GRCm39) F1244I probably damaging Het
Kcnk7 T C 19: 5,754,736 (GRCm39) V78A probably damaging Het
Kit A G 5: 75,799,791 (GRCm39) N508D probably benign Het
Klk1b22 A T 7: 43,764,277 (GRCm39) E68D probably benign Het
Klra4 C T 6: 130,021,019 (GRCm39) D259N probably benign Het
Krtap2-4 A T 11: 99,505,246 (GRCm39) C122S unknown Het
Map3k1 T G 13: 111,889,015 (GRCm39) H1314P possibly damaging Het
Mast2 C T 4: 116,168,875 (GRCm39) probably null Het
Mfsd2a A G 4: 122,843,102 (GRCm39) V393A probably benign Het
Myh7b T A 2: 155,475,182 (GRCm39) V1858E probably benign Het
Myo1c G A 11: 75,561,072 (GRCm39) V793I probably benign Het
Myt1l T A 12: 29,970,351 (GRCm39) N1145K unknown Het
Nckap1l T A 15: 103,387,242 (GRCm39) S706T probably benign Het
Nos2 A G 11: 78,846,290 (GRCm39) probably null Het
Odf2l C T 3: 144,833,820 (GRCm39) S160L probably benign Het
Or10ag54 T A 2: 87,099,743 (GRCm39) M206K probably benign Het
Or2av9 T C 11: 58,381,063 (GRCm39) I173V possibly damaging Het
Or4p18 A G 2: 88,233,137 (GRCm39) I47T probably damaging Het
Or56b34 T C 7: 104,937,435 (GRCm39) L45P possibly damaging Het
Or8g53 T C 9: 39,683,886 (GRCm39) D70G probably damaging Het
Pclo T C 5: 14,838,464 (GRCm39) W1424R Het
Pde8a A G 7: 80,956,498 (GRCm39) N299S probably benign Het
Pi4kb C T 3: 94,900,344 (GRCm39) T326M probably damaging Het
Pip4k2c A T 10: 127,037,037 (GRCm39) H177Q probably damaging Het
Pld1 T A 3: 28,177,846 (GRCm39) W686R Het
Ppp1r3b A T 8: 35,851,419 (GRCm39) D86V probably damaging Het
Ppp1r3g C T 13: 36,153,143 (GRCm39) R188* probably null Het
Pramel48 G T 5: 95,630,939 (GRCm39) C272F possibly damaging Het
Ptbp1 A G 10: 79,699,023 (GRCm39) E527G probably damaging Het
Rasef T C 4: 73,698,558 (GRCm39) probably benign Het
Rce1 A T 19: 4,675,532 (GRCm39) C34S unknown Het
Rnf144a T C 12: 26,370,948 (GRCm39) probably benign Het
Rpl7 C T 1: 16,173,485 (GRCm39) R88H possibly damaging Het
Rubcnl A T 14: 75,269,359 (GRCm39) T6S Het
Samd9l A T 6: 3,374,990 (GRCm39) V757D probably damaging Het
Sec22c A G 9: 121,514,638 (GRCm39) V221A probably benign Het
Slc16a6 A G 11: 109,345,932 (GRCm39) Y444H probably benign Het
Slc6a15 A T 10: 103,225,179 (GRCm39) Y89F probably damaging Het
Smg1 A G 7: 117,739,006 (GRCm39) V3466A probably benign Het
Sobp G A 10: 43,036,824 (GRCm39) T38I probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Srsf5 T A 12: 80,996,278 (GRCm39) F151I probably damaging Het
Taf2 A C 15: 54,928,001 (GRCm39) L134R possibly damaging Het
Tbc1d1 A G 5: 64,442,020 (GRCm39) probably benign Het
Thap1 C T 8: 26,648,261 (GRCm39) probably benign Het
Tmc5 A T 7: 118,222,332 (GRCm39) M11L probably benign Het
Tnfaip8 ACACACTCTCTCTCTC AC 18: 50,179,908 (GRCm39) probably benign Het
Tomm7 T C 5: 24,049,047 (GRCm39) K9E possibly damaging Het
Trem3 T C 17: 48,556,865 (GRCm39) V112A probably benign Het
Vmn1r178 G A 7: 23,593,264 (GRCm39) C104Y probably damaging Het
Zdhhc20 A T 14: 58,080,721 (GRCm39) S263T possibly damaging Het
Zdhhc20 A G 14: 58,103,089 (GRCm39) S87P probably benign Het
Zfp423 C A 8: 88,507,827 (GRCm39) C839F probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATTCCGGTGCAGCTTCATC -3'
(R):5'- AACTGACGTTGGCAGATGCG -3'

Sequencing Primer
(F):5'- AGCTTCATCTCTGCATCGAGGG -3'
(R):5'- CAGATGCGTTGTGTGATAAGTACC -3'
Posted On 2021-07-15