Incidental Mutation 'R8832:Cadps2'
ID 673906
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, cpd2, A230044C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8832 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 23262773-23839421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23587537 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 318 (L318Q)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000018122
AA Change: L318Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: L318Q

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115356
AA Change: L318Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
AA Change: L318Q

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115361
AA Change: L318Q

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125350
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142913
AA Change: L289Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: L289Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
AA Change: L318Q

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: L318Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: L289Q

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: L289Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
9330159F19Rik A T 10: 29,224,345 E238V probably damaging Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Agmat G A 4: 141,747,009 R67H probably benign Het
AI182371 T C 2: 35,095,897 D49G unknown Het
Ak7 A G 12: 105,742,339 N351S possibly damaging Het
Aldh3b1 G T 19: 3,914,025 R426S probably damaging Het
Aldh4a1 A G 4: 139,644,155 D460G probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Arhgap32 C T 9: 32,260,819 P1632S possibly damaging Het
Armh1 A G 4: 117,237,670 F58L probably damaging Het
Baz1b C T 5: 135,217,376 R560W possibly damaging Het
Bbs10 C T 10: 111,300,405 Q460* probably null Het
BC034090 A C 1: 155,226,288 S77A probably damaging Het
Brca2 A G 5: 150,542,146 K1792E possibly damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Cobll1 A T 2: 65,099,258 S575T probably damaging Het
Col6a4 A G 9: 106,072,154 Y761H probably benign Het
Cyp2j9 G T 4: 96,585,884 H106Q probably benign Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
Dennd2c T A 3: 103,152,404 probably null Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Fmnl2 A G 2: 53,054,572 S188G Het
Ggt1 A T 10: 75,574,339 H35L possibly damaging Het
Gphn A T 12: 78,412,400 silent Het
Hic1 G A 11: 75,166,902 A387V possibly damaging Het
Igf1r T A 7: 68,226,021 F1244I probably damaging Het
Kcnk7 T C 19: 5,704,708 V78A probably damaging Het
Kit A G 5: 75,639,131 N508D probably benign Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Klra4 C T 6: 130,044,056 D259N probably benign Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mast2 C T 4: 116,311,678 probably null Het
Mfsd2a A G 4: 122,949,309 V393A probably benign Het
Myh7b T A 2: 155,633,262 V1858E probably benign Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Myt1l T A 12: 29,920,352 N1145K unknown Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Nos2 A G 11: 78,955,464 probably null Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1116 T A 2: 87,269,399 M206K probably benign Het
Olfr1179 A G 2: 88,402,793 I47T probably damaging Het
Olfr332 T C 11: 58,490,237 I173V possibly damaging Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr968 T C 9: 39,772,590 D70G probably damaging Het
Pclo T C 5: 14,788,450 W1424R Het
Pde8a A G 7: 81,306,750 N299S probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Pld1 T A 3: 28,123,697 W686R Het
Ppp1r3b A T 8: 35,384,265 D86V probably damaging Het
Ppp1r3g C T 13: 35,969,160 R188* probably null Het
Ptbp1 A G 10: 79,863,189 E527G probably damaging Het
Rasef T C 4: 73,780,321 probably benign Het
Rce1 A T 19: 4,625,504 C34S unknown Het
Rnf144a T C 12: 26,320,949 probably benign Het
Rpl7 C T 1: 16,103,261 R88H possibly damaging Het
Rubcnl A T 14: 75,031,919 T6S Het
Samd9l A T 6: 3,374,990 V757D probably damaging Het
Sec22c A G 9: 121,685,572 V221A probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Slc6a15 A T 10: 103,389,318 Y89F probably damaging Het
Smg1 A G 7: 118,139,783 V3466A probably benign Het
Sobp G A 10: 43,160,828 T38I probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srsf5 T A 12: 80,949,504 F151I probably damaging Het
Taf2 A C 15: 55,064,605 L134R possibly damaging Het
Tbc1d1 A G 5: 64,284,677 probably benign Het
Thap1 C T 8: 26,158,233 probably benign Het
Tmc5 A T 7: 118,623,109 M11L probably benign Het
Tnfaip8 ACACACTCTCTCTCTC AC 18: 50,046,841 probably benign Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zdhhc20 A T 14: 57,843,264 S263T possibly damaging Het
Zdhhc20 A G 14: 57,865,632 S87P probably benign Het
Zfp423 C A 8: 87,781,199 C839F probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8082:Cadps2 UTSW 6 23323314 missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8768:Cadps2 UTSW 6 23382939 missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23302304 missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
R8848:Cadps2 UTSW 6 23344257 missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23385508 missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23410877 missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23344224 missense probably benign 0.11
R8921:Cadps2 UTSW 6 23302301 missense probably benign 0.00
R9228:Cadps2 UTSW 6 23688928 missense probably benign 0.00
R9297:Cadps2 UTSW 6 23496888 missense probably benign
R9318:Cadps2 UTSW 6 23496888 missense probably benign
R9348:Cadps2 UTSW 6 23344263 missense probably benign 0.20
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCGGTGCAGCTTCATC -3'
(R):5'- AACTGACGTTGGCAGATGCG -3'

Sequencing Primer
(F):5'- AGCTTCATCTCTGCATCGAGGG -3'
(R):5'- CAGATGCGTTGTGTGATAAGTACC -3'
Posted On 2021-07-15