Mutagenetix > Incidental Mutation

Incidental Mutation 'R8832:Cadps2'

673906

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

068660-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8832 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23587537 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 318 (L318Q)

Ref Sequence

ENSEMBL: ENSMUSP00000111018 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018122
AA Change: L318Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: L318Q

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000069074
AA Change: L318Q

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: L318Q

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115356
AA Change: L318Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: L318Q

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115358
AA Change: L318Q

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: L318Q

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115361
AA Change: L318Q

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: L318Q

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125350

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000142913
AA Change: L289Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: L289Q

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163871
AA Change: L318Q

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: L318Q

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166458
AA Change: L289Q

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: L289Q

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700125H20Rik	A	G	11: 85,171,211	D12G	probably damaging	Het
2610507B11Rik	A	G	11: 78,267,238	K409E	probably benign	Het
9330159F19Rik	A	T	10: 29,224,345	E238V	probably damaging	Het
Adh6b	T	C	3: 138,349,702	V71A	probably benign	Het
Agmat	G	A	4: 141,747,009	R67H	probably benign	Het
AI182371	T	C	2: 35,095,897	D49G	unknown	Het
Ak7	A	G	12: 105,742,339	N351S	possibly damaging	Het
Aldh3b1	G	T	19: 3,914,025	R426S	probably damaging	Het
Aldh4a1	A	G	4: 139,644,155	D460G	probably benign	Het
Aox4	A	T	1: 58,255,490	M953L	probably benign	Het
Arhgap32	C	T	9: 32,260,819	P1632S	possibly damaging	Het
Armh1	A	G	4: 117,237,670	F58L	probably damaging	Het
Baz1b	C	T	5: 135,217,376	R560W	possibly damaging	Het
Bbs10	C	T	10: 111,300,405	Q460*	probably null	Het
BC034090	A	C	1: 155,226,288	S77A	probably damaging	Het
Brca2	A	G	5: 150,542,146	K1792E	possibly damaging	Het
Catsperg2	A	G	7: 29,697,844	V1078A	probably benign	Het
Ccno	A	G	13: 112,989,705	N236S	probably benign	Het
Cobll1	A	T	2: 65,099,258	S575T	probably damaging	Het
Col6a4	A	G	9: 106,072,154	Y761H	probably benign	Het
Cyp2j9	G	T	4: 96,585,884	H106Q	probably benign	Het
D5Ertd577e	G	T	5: 95,483,080	C272F	possibly damaging	Het
Dennd2c	T	A	3: 103,152,404		probably null	Het
Drd5	G	A	5: 38,319,735	V24M	probably benign	Het
Dthd1	T	C	5: 62,814,265	S144P	probably benign	Het
Fam126b	A	T	1: 58,548,673	I127N	possibly damaging	Het
Fcna	C	A	2: 25,626,133	R124L	possibly damaging	Het
Fmnl2	A	G	2: 53,054,572	S188G		Het
Ggt1	A	T	10: 75,574,339	H35L	possibly damaging	Het
Gphn	A	T	12: 78,412,400		silent	Het
Hic1	G	A	11: 75,166,902	A387V	possibly damaging	Het
Igf1r	T	A	7: 68,226,021	F1244I	probably damaging	Het
Kcnk7	T	C	19: 5,704,708	V78A	probably damaging	Het
Kit	A	G	5: 75,639,131	N508D	probably benign	Het
Klk1b22	A	T	7: 44,114,853	E68D	probably benign	Het
Klra4	C	T	6: 130,044,056	D259N	probably benign	Het
Krtap2-4	A	T	11: 99,614,420	C122S	unknown	Het
Map3k1	T	G	13: 111,752,481	H1314P	possibly damaging	Het
Mast2	C	T	4: 116,311,678		probably null	Het
Mfsd2a	A	G	4: 122,949,309	V393A	probably benign	Het
Myh7b	T	A	2: 155,633,262	V1858E	probably benign	Het
Myo1c	G	A	11: 75,670,246	V793I	probably benign	Het
Myt1l	T	A	12: 29,920,352	N1145K	unknown	Het
Nckap1l	T	A	15: 103,478,815	S706T	probably benign	Het
Nos2	A	G	11: 78,955,464		probably null	Het
Odf2l	C	T	3: 145,128,059	S160L	probably benign	Het
Olfr1116	T	A	2: 87,269,399	M206K	probably benign	Het
Olfr1179	A	G	2: 88,402,793	I47T	probably damaging	Het
Olfr332	T	C	11: 58,490,237	I173V	possibly damaging	Het
Olfr688	T	C	7: 105,288,228	L45P	possibly damaging	Het
Olfr968	T	C	9: 39,772,590	D70G	probably damaging	Het
Pclo	T	C	5: 14,788,450	W1424R		Het
Pde8a	A	G	7: 81,306,750	N299S	probably benign	Het
Pi4kb	C	T	3: 94,993,033	T326M	probably damaging	Het
Pip4k2c	A	T	10: 127,201,168	H177Q	probably damaging	Het
Pld1	T	A	3: 28,123,697	W686R		Het
Ppp1r3b	A	T	8: 35,384,265	D86V	probably damaging	Het
Ppp1r3g	C	T	13: 35,969,160	R188*	probably null	Het
Ptbp1	A	G	10: 79,863,189	E527G	probably damaging	Het
Rasef	T	C	4: 73,780,321		probably benign	Het
Rce1	A	T	19: 4,625,504	C34S	unknown	Het
Rnf144a	T	C	12: 26,320,949		probably benign	Het
Rpl7	C	T	1: 16,103,261	R88H	possibly damaging	Het
Rubcnl	A	T	14: 75,031,919	T6S		Het
Samd9l	A	T	6: 3,374,990	V757D	probably damaging	Het
Sec22c	A	G	9: 121,685,572	V221A	probably benign	Het
Slc16a6	A	G	11: 109,455,106	Y444H	probably benign	Het
Slc6a15	A	T	10: 103,389,318	Y89F	probably damaging	Het
Smg1	A	G	7: 118,139,783	V3466A	probably benign	Het
Sobp	G	A	10: 43,160,828	T38I	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Srsf5	T	A	12: 80,949,504	F151I	probably damaging	Het
Taf2	A	C	15: 55,064,605	L134R	possibly damaging	Het
Tbc1d1	A	G	5: 64,284,677		probably benign	Het
Thap1	C	T	8: 26,158,233		probably benign	Het
Tmc5	A	T	7: 118,623,109	M11L	probably benign	Het
Tnfaip8	ACACACTCTCTCTCTC	AC	18: 50,046,841		probably benign	Het
Tomm7	T	C	5: 23,844,049	K9E	possibly damaging	Het
Trem3	T	C	17: 48,249,837	V112A	probably benign	Het
Vmn1r178	G	A	7: 23,893,839	C104Y	probably damaging	Het
Zdhhc20	A	T	14: 57,843,264	S263T	possibly damaging	Het
Zdhhc20	A	G	14: 57,865,632	S87P	probably benign	Het
Zfp423	C	A	8: 87,781,199	C839F	probably damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCCGGTGCAGCTTCATC -3'
(R):5'- AACTGACGTTGGCAGATGCG -3'

Sequencing Primer
(F):5'- AGCTTCATCTCTGCATCGAGGG -3'
(R):5'- CAGATGCGTTGTGTGATAAGTACC -3'

Posted On

2021-07-15