Incidental Mutation 'R8832:Igf1r'
ID673911
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8832 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68226021 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1244 (F1244I)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect probably damaging
Transcript: ENSMUST00000005671
AA Change: F1244I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: F1244I

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
9330159F19Rik A T 10: 29,224,345 E238V probably damaging Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Agmat G A 4: 141,747,009 R67H probably benign Het
Ak7 A G 12: 105,742,339 N351S possibly damaging Het
Aldh3b1 G T 19: 3,914,025 R426S probably damaging Het
Aldh4a1 A G 4: 139,644,155 D460G probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Arhgap32 C T 9: 32,260,819 P1632S possibly damaging Het
Armh1 A G 4: 117,237,670 F58L probably damaging Het
Baz1b C T 5: 135,217,376 R560W possibly damaging Het
Bbs10 C T 10: 111,300,405 Q460* probably null Het
BC034090 A C 1: 155,226,288 S77A probably damaging Het
Brca2 A G 5: 150,542,146 K1792E possibly damaging Het
Cadps2 A T 6: 23,587,537 L318Q possibly damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Cobll1 A T 2: 65,099,258 S575T probably damaging Het
Col6a4 A G 9: 106,072,154 Y761H probably benign Het
Cyp2j9 G T 4: 96,585,884 H106Q probably benign Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
Dennd2c T A 3: 103,152,404 probably null Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Fmnl2 A G 2: 53,054,572 S188G Het
Ggt1 A T 10: 75,574,339 H35L possibly damaging Het
Hic1 G A 11: 75,166,902 A387V possibly damaging Het
Kcnk7 T C 19: 5,704,708 V78A probably damaging Het
Kit A G 5: 75,639,131 N508D probably benign Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Klra4 C T 6: 130,044,056 D259N probably benign Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mast2 C T 4: 116,311,678 probably null Het
Mfsd2a A G 4: 122,949,309 V393A probably benign Het
Myh7b T A 2: 155,633,262 V1858E probably benign Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Myt1l T A 12: 29,920,352 N1145K unknown Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Nos2 A G 11: 78,955,464 probably null Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1116 T A 2: 87,269,399 M206K probably benign Het
Olfr1179 A G 2: 88,402,793 I47T probably damaging Het
Olfr332 T C 11: 58,490,237 I173V possibly damaging Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr968 T C 9: 39,772,590 D70G probably damaging Het
Pclo T C 5: 14,788,450 W1424R Het
Pde8a A G 7: 81,306,750 N299S probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Pld1 T A 3: 28,123,697 W686R Het
Ppp1r3b A T 8: 35,384,265 D86V probably damaging Het
Ppp1r3g C T 13: 35,969,160 R188* probably null Het
Ptbp1 TCTGCTGCTGCTGCTGCTGC TCTGCTGCTGCTGCTGC 10: 79,860,874 probably benign Het
Ptbp1 A G 10: 79,863,189 E527G probably damaging Het
Rce1 A T 19: 4,625,504 C34S unknown Het
Rpl7 C T 1: 16,103,261 R88H possibly damaging Het
Rubcnl A T 14: 75,031,919 T6S Het
Samd9l A T 6: 3,374,990 V757D probably damaging Het
Sec22c A G 9: 121,685,572 V221A probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Slc6a15 A T 10: 103,389,318 Y89F probably damaging Het
Smg1 A G 7: 118,139,783 V3466A probably benign Het
Sobp G A 10: 43,160,828 T38I probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Srsf5 T A 12: 80,949,504 F151I probably damaging Het
Taf2 A C 15: 55,064,605 L134R possibly damaging Het
Tmc5 A T 7: 118,623,109 M11L probably benign Het
Tnfaip8 ACACACTCTCTCTCTC AC 18: 50,046,841 probably benign Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zdhhc20 A T 14: 57,843,264 S263T possibly damaging Het
Zdhhc20 A G 14: 57,865,632 S87P probably benign Het
Zfp423 C A 8: 87,781,199 C839F probably damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Hungarian UTSW 7 68214997 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
R8458:Igf1r UTSW 7 68195629 missense probably benign
R8539:Igf1r UTSW 7 68003848 missense probably benign 0.06
R8704:Igf1r UTSW 7 68170054 splice site probably benign
R8746:Igf1r UTSW 7 68214997 missense probably damaging 1.00
R8829:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8859:Igf1r UTSW 7 68183463 missense possibly damaging 0.75
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Z1186:Igf1r UTSW 7 68226168 small insertion probably benign
Z1186:Igf1r UTSW 7 68226169 small insertion probably benign
Z1186:Igf1r UTSW 7 68226174 small insertion probably benign
Z1186:Igf1r UTSW 7 68226180 small insertion probably benign
Z1186:Igf1r UTSW 7 68226182 small insertion probably benign
Z1191:Igf1r UTSW 7 68226169 small insertion probably benign
Z1191:Igf1r UTSW 7 68226170 small insertion probably benign
Z1191:Igf1r UTSW 7 68226173 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGAACCAAGACTTGAAGTGAGTC -3'
(R):5'- AGTGTCTTTCAGGCAGAGGC -3'

Sequencing Primer
(F):5'- AAGTGAGTCTGGGCTTGGCAC -3'
(R):5'- GGGACGCTCTCCATGTTCTCAG -3'
Posted On2021-07-15