Incidental Mutation 'R8832:Sppl2b'
ID673927
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R8832 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80866069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,171,211 D12G probably damaging Het
2610507B11Rik A G 11: 78,267,238 K409E probably benign Het
9330159F19Rik A T 10: 29,224,345 E238V probably damaging Het
Adh6b T C 3: 138,349,702 V71A probably benign Het
Agmat G A 4: 141,747,009 R67H probably benign Het
Ak7 A G 12: 105,742,339 N351S possibly damaging Het
Aldh3b1 G T 19: 3,914,025 R426S probably damaging Het
Aldh4a1 A G 4: 139,644,155 D460G probably benign Het
Aox4 A T 1: 58,255,490 M953L probably benign Het
Arhgap32 C T 9: 32,260,819 P1632S possibly damaging Het
Armh1 A G 4: 117,237,670 F58L probably damaging Het
Baz1b C T 5: 135,217,376 R560W possibly damaging Het
Bbs10 C T 10: 111,300,405 Q460* probably null Het
BC034090 A C 1: 155,226,288 S77A probably damaging Het
Brca2 A G 5: 150,542,146 K1792E possibly damaging Het
Cadps2 A T 6: 23,587,537 L318Q possibly damaging Het
Catsperg2 A G 7: 29,697,844 V1078A probably benign Het
Ccno A G 13: 112,989,705 N236S probably benign Het
Cobll1 A T 2: 65,099,258 S575T probably damaging Het
Col6a4 A G 9: 106,072,154 Y761H probably benign Het
Cyp2j9 G T 4: 96,585,884 H106Q probably benign Het
D5Ertd577e G T 5: 95,483,080 C272F possibly damaging Het
Dennd2c T A 3: 103,152,404 probably null Het
Drd5 G A 5: 38,319,735 V24M probably benign Het
Dthd1 T C 5: 62,814,265 S144P probably benign Het
Fam126b A T 1: 58,548,673 I127N possibly damaging Het
Fcna C A 2: 25,626,133 R124L possibly damaging Het
Fmnl2 A G 2: 53,054,572 S188G Het
Ggt1 A T 10: 75,574,339 H35L possibly damaging Het
Hic1 G A 11: 75,166,902 A387V possibly damaging Het
Igf1r T A 7: 68,226,021 F1244I probably damaging Het
Kcnk7 T C 19: 5,704,708 V78A probably damaging Het
Kit A G 5: 75,639,131 N508D probably benign Het
Klk1b22 A T 7: 44,114,853 E68D probably benign Het
Klra4 C T 6: 130,044,056 D259N probably benign Het
Krtap2-4 A T 11: 99,614,420 C122S unknown Het
Map3k1 T G 13: 111,752,481 H1314P possibly damaging Het
Mast2 C T 4: 116,311,678 probably null Het
Mfsd2a A G 4: 122,949,309 V393A probably benign Het
Myh7b T A 2: 155,633,262 V1858E probably benign Het
Myo1c G A 11: 75,670,246 V793I probably benign Het
Myt1l T A 12: 29,920,352 N1145K unknown Het
Nckap1l T A 15: 103,478,815 S706T probably benign Het
Nos2 A G 11: 78,955,464 probably null Het
Odf2l C T 3: 145,128,059 S160L probably benign Het
Olfr1116 T A 2: 87,269,399 M206K probably benign Het
Olfr1179 A G 2: 88,402,793 I47T probably damaging Het
Olfr332 T C 11: 58,490,237 I173V possibly damaging Het
Olfr688 T C 7: 105,288,228 L45P possibly damaging Het
Olfr968 T C 9: 39,772,590 D70G probably damaging Het
Pclo T C 5: 14,788,450 W1424R Het
Pde8a A G 7: 81,306,750 N299S probably benign Het
Pi4kb C T 3: 94,993,033 T326M probably damaging Het
Pip4k2c A T 10: 127,201,168 H177Q probably damaging Het
Pld1 T A 3: 28,123,697 W686R Het
Ppp1r3b A T 8: 35,384,265 D86V probably damaging Het
Ppp1r3g C T 13: 35,969,160 R188* probably null Het
Ptbp1 TCTGCTGCTGCTGCTGCTGC TCTGCTGCTGCTGCTGC 10: 79,860,874 probably benign Het
Ptbp1 A G 10: 79,863,189 E527G probably damaging Het
Rce1 A T 19: 4,625,504 C34S unknown Het
Rpl7 C T 1: 16,103,261 R88H possibly damaging Het
Rubcnl A T 14: 75,031,919 T6S Het
Samd9l A T 6: 3,374,990 V757D probably damaging Het
Sec22c A G 9: 121,685,572 V221A probably benign Het
Slc16a6 A G 11: 109,455,106 Y444H probably benign Het
Slc6a15 A T 10: 103,389,318 Y89F probably damaging Het
Smg1 A G 7: 118,139,783 V3466A probably benign Het
Sobp G A 10: 43,160,828 T38I probably damaging Het
Srsf5 T A 12: 80,949,504 F151I probably damaging Het
Taf2 A C 15: 55,064,605 L134R possibly damaging Het
Tmc5 A T 7: 118,623,109 M11L probably benign Het
Tnfaip8 ACACACTCTCTCTCTC AC 18: 50,046,841 probably benign Het
Tomm7 T C 5: 23,844,049 K9E possibly damaging Het
Trem3 T C 17: 48,249,837 V112A probably benign Het
Vmn1r178 G A 7: 23,893,839 C104Y probably damaging Het
Zdhhc20 A T 14: 57,843,264 S263T possibly damaging Het
Zdhhc20 A G 14: 57,865,632 S87P probably benign Het
Zfp423 C A 8: 87,781,199 C839F probably damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATGTGCATGCCCATTGTCACC -3'
(R):5'- TTGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On2021-07-15