Incidental Mutation 'R8832:Sppl2b'
ID 673927
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission 068660-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R8832 (G1)
Quality Score 217.468
Status Not validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80701903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
AlphaFold Q3TD49
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,100,341 (GRCm39) E238V probably damaging Het
Adh6b T C 3: 138,055,463 (GRCm39) V71A probably benign Het
Agmat G A 4: 141,474,320 (GRCm39) R67H probably benign Het
AI182371 T C 2: 34,985,909 (GRCm39) D49G unknown Het
Ak7 A G 12: 105,708,598 (GRCm39) N351S possibly damaging Het
Aldh3b1 G T 19: 3,964,025 (GRCm39) R426S probably damaging Het
Aldh4a1 A G 4: 139,371,466 (GRCm39) D460G probably benign Het
Aox4 A T 1: 58,294,649 (GRCm39) M953L probably benign Het
Arhgap32 C T 9: 32,172,115 (GRCm39) P1632S possibly damaging Het
Armh1 A G 4: 117,094,867 (GRCm39) F58L probably damaging Het
Baz1b C T 5: 135,246,230 (GRCm39) R560W possibly damaging Het
Bbs10 C T 10: 111,136,266 (GRCm39) Q460* probably null Het
BC034090 A C 1: 155,102,034 (GRCm39) S77A probably damaging Het
Bltp2 A G 11: 78,158,064 (GRCm39) K409E probably benign Het
Brca2 A G 5: 150,465,611 (GRCm39) K1792E possibly damaging Het
Cadps2 A T 6: 23,587,536 (GRCm39) L318Q possibly damaging Het
Catsperg2 A G 7: 29,397,269 (GRCm39) V1078A probably benign Het
Ccno A G 13: 113,126,239 (GRCm39) N236S probably benign Het
Chct1 A G 11: 85,062,037 (GRCm39) D12G probably damaging Het
Cobll1 A T 2: 64,929,602 (GRCm39) S575T probably damaging Het
Col6a4 A G 9: 105,949,353 (GRCm39) Y761H probably benign Het
Cyp2j9 G T 4: 96,474,121 (GRCm39) H106Q probably benign Het
Dennd2c T A 3: 103,059,720 (GRCm39) probably null Het
Drd5 G A 5: 38,477,078 (GRCm39) V24M probably benign Het
Dthd1 T C 5: 62,971,608 (GRCm39) S144P probably benign Het
Fcna C A 2: 25,516,145 (GRCm39) R124L possibly damaging Het
Fmnl2 A G 2: 52,944,584 (GRCm39) S188G Het
Ggt1 A T 10: 75,410,173 (GRCm39) H35L possibly damaging Het
Gphn A T 12: 78,459,174 (GRCm39) silent Het
Hic1 G A 11: 75,057,728 (GRCm39) A387V possibly damaging Het
Hycc2 A T 1: 58,587,832 (GRCm39) I127N possibly damaging Het
Igf1r T A 7: 67,875,769 (GRCm39) F1244I probably damaging Het
Kcnk7 T C 19: 5,754,736 (GRCm39) V78A probably damaging Het
Kit A G 5: 75,799,791 (GRCm39) N508D probably benign Het
Klk1b22 A T 7: 43,764,277 (GRCm39) E68D probably benign Het
Klra4 C T 6: 130,021,019 (GRCm39) D259N probably benign Het
Krtap2-4 A T 11: 99,505,246 (GRCm39) C122S unknown Het
Map3k1 T G 13: 111,889,015 (GRCm39) H1314P possibly damaging Het
Mast2 C T 4: 116,168,875 (GRCm39) probably null Het
Mfsd2a A G 4: 122,843,102 (GRCm39) V393A probably benign Het
Myh7b T A 2: 155,475,182 (GRCm39) V1858E probably benign Het
Myo1c G A 11: 75,561,072 (GRCm39) V793I probably benign Het
Myt1l T A 12: 29,970,351 (GRCm39) N1145K unknown Het
Nckap1l T A 15: 103,387,242 (GRCm39) S706T probably benign Het
Nos2 A G 11: 78,846,290 (GRCm39) probably null Het
Odf2l C T 3: 144,833,820 (GRCm39) S160L probably benign Het
Or10ag54 T A 2: 87,099,743 (GRCm39) M206K probably benign Het
Or2av9 T C 11: 58,381,063 (GRCm39) I173V possibly damaging Het
Or4p18 A G 2: 88,233,137 (GRCm39) I47T probably damaging Het
Or56b34 T C 7: 104,937,435 (GRCm39) L45P possibly damaging Het
Or8g53 T C 9: 39,683,886 (GRCm39) D70G probably damaging Het
Pclo T C 5: 14,838,464 (GRCm39) W1424R Het
Pde8a A G 7: 80,956,498 (GRCm39) N299S probably benign Het
Pi4kb C T 3: 94,900,344 (GRCm39) T326M probably damaging Het
Pip4k2c A T 10: 127,037,037 (GRCm39) H177Q probably damaging Het
Pld1 T A 3: 28,177,846 (GRCm39) W686R Het
Ppp1r3b A T 8: 35,851,419 (GRCm39) D86V probably damaging Het
Ppp1r3g C T 13: 36,153,143 (GRCm39) R188* probably null Het
Pramel48 G T 5: 95,630,939 (GRCm39) C272F possibly damaging Het
Ptbp1 A G 10: 79,699,023 (GRCm39) E527G probably damaging Het
Rasef T C 4: 73,698,558 (GRCm39) probably benign Het
Rce1 A T 19: 4,675,532 (GRCm39) C34S unknown Het
Rnf144a T C 12: 26,370,948 (GRCm39) probably benign Het
Rpl7 C T 1: 16,173,485 (GRCm39) R88H possibly damaging Het
Rubcnl A T 14: 75,269,359 (GRCm39) T6S Het
Samd9l A T 6: 3,374,990 (GRCm39) V757D probably damaging Het
Sec22c A G 9: 121,514,638 (GRCm39) V221A probably benign Het
Slc16a6 A G 11: 109,345,932 (GRCm39) Y444H probably benign Het
Slc6a15 A T 10: 103,225,179 (GRCm39) Y89F probably damaging Het
Smg1 A G 7: 117,739,006 (GRCm39) V3466A probably benign Het
Sobp G A 10: 43,036,824 (GRCm39) T38I probably damaging Het
Srsf5 T A 12: 80,996,278 (GRCm39) F151I probably damaging Het
Taf2 A C 15: 54,928,001 (GRCm39) L134R possibly damaging Het
Tbc1d1 A G 5: 64,442,020 (GRCm39) probably benign Het
Thap1 C T 8: 26,648,261 (GRCm39) probably benign Het
Tmc5 A T 7: 118,222,332 (GRCm39) M11L probably benign Het
Tnfaip8 ACACACTCTCTCTCTC AC 18: 50,179,908 (GRCm39) probably benign Het
Tomm7 T C 5: 24,049,047 (GRCm39) K9E possibly damaging Het
Trem3 T C 17: 48,556,865 (GRCm39) V112A probably benign Het
Vmn1r178 G A 7: 23,593,264 (GRCm39) C104Y probably damaging Het
Zdhhc20 A T 14: 58,080,721 (GRCm39) S263T possibly damaging Het
Zdhhc20 A G 14: 58,103,089 (GRCm39) S87P probably benign Het
Zfp423 C A 8: 88,507,827 (GRCm39) C839F probably damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80,701,451 (GRCm39) missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R4350:Sppl2b UTSW 10 80,698,560 (GRCm39) missense probably benign 0.12
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8265:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8480:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8505:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8817:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
R9624:Sppl2b UTSW 10 80,699,373 (GRCm39) missense probably benign 0.03
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATGTGCATGCCCATTGTCACC -3'
(R):5'- TTGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On 2021-07-15