Incidental Mutation 'R8832:Slc6a15'
ID 673928
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 068660-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8832 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103225179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 89 (Y89F)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636] [ENSMUST00000217905]
AlphaFold Q8BG16
Predicted Effect probably damaging
Transcript: ENSMUST00000074204
AA Change: Y89F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: Y89F

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179636
AA Change: Y89F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: Y89F

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217905
AA Change: Y89F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5824 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,100,341 (GRCm39) E238V probably damaging Het
Adh6b T C 3: 138,055,463 (GRCm39) V71A probably benign Het
Agmat G A 4: 141,474,320 (GRCm39) R67H probably benign Het
AI182371 T C 2: 34,985,909 (GRCm39) D49G unknown Het
Ak7 A G 12: 105,708,598 (GRCm39) N351S possibly damaging Het
Aldh3b1 G T 19: 3,964,025 (GRCm39) R426S probably damaging Het
Aldh4a1 A G 4: 139,371,466 (GRCm39) D460G probably benign Het
Aox4 A T 1: 58,294,649 (GRCm39) M953L probably benign Het
Arhgap32 C T 9: 32,172,115 (GRCm39) P1632S possibly damaging Het
Armh1 A G 4: 117,094,867 (GRCm39) F58L probably damaging Het
Baz1b C T 5: 135,246,230 (GRCm39) R560W possibly damaging Het
Bbs10 C T 10: 111,136,266 (GRCm39) Q460* probably null Het
BC034090 A C 1: 155,102,034 (GRCm39) S77A probably damaging Het
Bltp2 A G 11: 78,158,064 (GRCm39) K409E probably benign Het
Brca2 A G 5: 150,465,611 (GRCm39) K1792E possibly damaging Het
Cadps2 A T 6: 23,587,536 (GRCm39) L318Q possibly damaging Het
Catsperg2 A G 7: 29,397,269 (GRCm39) V1078A probably benign Het
Ccno A G 13: 113,126,239 (GRCm39) N236S probably benign Het
Chct1 A G 11: 85,062,037 (GRCm39) D12G probably damaging Het
Cobll1 A T 2: 64,929,602 (GRCm39) S575T probably damaging Het
Col6a4 A G 9: 105,949,353 (GRCm39) Y761H probably benign Het
Cyp2j9 G T 4: 96,474,121 (GRCm39) H106Q probably benign Het
Dennd2c T A 3: 103,059,720 (GRCm39) probably null Het
Drd5 G A 5: 38,477,078 (GRCm39) V24M probably benign Het
Dthd1 T C 5: 62,971,608 (GRCm39) S144P probably benign Het
Fcna C A 2: 25,516,145 (GRCm39) R124L possibly damaging Het
Fmnl2 A G 2: 52,944,584 (GRCm39) S188G Het
Ggt1 A T 10: 75,410,173 (GRCm39) H35L possibly damaging Het
Gphn A T 12: 78,459,174 (GRCm39) silent Het
Hic1 G A 11: 75,057,728 (GRCm39) A387V possibly damaging Het
Hycc2 A T 1: 58,587,832 (GRCm39) I127N possibly damaging Het
Igf1r T A 7: 67,875,769 (GRCm39) F1244I probably damaging Het
Kcnk7 T C 19: 5,754,736 (GRCm39) V78A probably damaging Het
Kit A G 5: 75,799,791 (GRCm39) N508D probably benign Het
Klk1b22 A T 7: 43,764,277 (GRCm39) E68D probably benign Het
Klra4 C T 6: 130,021,019 (GRCm39) D259N probably benign Het
Krtap2-4 A T 11: 99,505,246 (GRCm39) C122S unknown Het
Map3k1 T G 13: 111,889,015 (GRCm39) H1314P possibly damaging Het
Mast2 C T 4: 116,168,875 (GRCm39) probably null Het
Mfsd2a A G 4: 122,843,102 (GRCm39) V393A probably benign Het
Myh7b T A 2: 155,475,182 (GRCm39) V1858E probably benign Het
Myo1c G A 11: 75,561,072 (GRCm39) V793I probably benign Het
Myt1l T A 12: 29,970,351 (GRCm39) N1145K unknown Het
Nckap1l T A 15: 103,387,242 (GRCm39) S706T probably benign Het
Nos2 A G 11: 78,846,290 (GRCm39) probably null Het
Odf2l C T 3: 144,833,820 (GRCm39) S160L probably benign Het
Or10ag54 T A 2: 87,099,743 (GRCm39) M206K probably benign Het
Or2av9 T C 11: 58,381,063 (GRCm39) I173V possibly damaging Het
Or4p18 A G 2: 88,233,137 (GRCm39) I47T probably damaging Het
Or56b34 T C 7: 104,937,435 (GRCm39) L45P possibly damaging Het
Or8g53 T C 9: 39,683,886 (GRCm39) D70G probably damaging Het
Pclo T C 5: 14,838,464 (GRCm39) W1424R Het
Pde8a A G 7: 80,956,498 (GRCm39) N299S probably benign Het
Pi4kb C T 3: 94,900,344 (GRCm39) T326M probably damaging Het
Pip4k2c A T 10: 127,037,037 (GRCm39) H177Q probably damaging Het
Pld1 T A 3: 28,177,846 (GRCm39) W686R Het
Ppp1r3b A T 8: 35,851,419 (GRCm39) D86V probably damaging Het
Ppp1r3g C T 13: 36,153,143 (GRCm39) R188* probably null Het
Pramel48 G T 5: 95,630,939 (GRCm39) C272F possibly damaging Het
Ptbp1 A G 10: 79,699,023 (GRCm39) E527G probably damaging Het
Rasef T C 4: 73,698,558 (GRCm39) probably benign Het
Rce1 A T 19: 4,675,532 (GRCm39) C34S unknown Het
Rnf144a T C 12: 26,370,948 (GRCm39) probably benign Het
Rpl7 C T 1: 16,173,485 (GRCm39) R88H possibly damaging Het
Rubcnl A T 14: 75,269,359 (GRCm39) T6S Het
Samd9l A T 6: 3,374,990 (GRCm39) V757D probably damaging Het
Sec22c A G 9: 121,514,638 (GRCm39) V221A probably benign Het
Slc16a6 A G 11: 109,345,932 (GRCm39) Y444H probably benign Het
Smg1 A G 7: 117,739,006 (GRCm39) V3466A probably benign Het
Sobp G A 10: 43,036,824 (GRCm39) T38I probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Srsf5 T A 12: 80,996,278 (GRCm39) F151I probably damaging Het
Taf2 A C 15: 54,928,001 (GRCm39) L134R possibly damaging Het
Tbc1d1 A G 5: 64,442,020 (GRCm39) probably benign Het
Thap1 C T 8: 26,648,261 (GRCm39) probably benign Het
Tmc5 A T 7: 118,222,332 (GRCm39) M11L probably benign Het
Tnfaip8 ACACACTCTCTCTCTC AC 18: 50,179,908 (GRCm39) probably benign Het
Tomm7 T C 5: 24,049,047 (GRCm39) K9E possibly damaging Het
Trem3 T C 17: 48,556,865 (GRCm39) V112A probably benign Het
Vmn1r178 G A 7: 23,593,264 (GRCm39) C104Y probably damaging Het
Zdhhc20 A T 14: 58,080,721 (GRCm39) S263T possibly damaging Het
Zdhhc20 A G 14: 58,103,089 (GRCm39) S87P probably benign Het
Zfp423 C A 8: 88,507,827 (GRCm39) C839F probably damaging Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103,254,248 (GRCm39) missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103,245,648 (GRCm39) missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5320:Slc6a15 UTSW 10 103,244,067 (GRCm39) missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103,229,890 (GRCm39) critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103,245,556 (GRCm39) missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103,230,953 (GRCm39) nonsense probably null
R9050:Slc6a15 UTSW 10 103,252,516 (GRCm39) missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9493:Slc6a15 UTSW 10 103,229,277 (GRCm39) missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103,240,583 (GRCm39) missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCAACGAAGACTCAGTG -3'
(R):5'- TGGAAACTTCATCTGAACCCAG -3'

Sequencing Primer
(F):5'- ACTCAGTGGAAGAGGTTTCTAAG -3'
(R):5'- TGGACTGACTTCCCACAAAAATGTG -3'
Posted On 2021-07-15