Incidental Mutation 'R8833:Vmn1r32'
ID673972
Institutional Source Beutler Lab
Gene Symbol Vmn1r32
Ensembl Gene ENSMUSG00000062905
Gene Namevomeronasal 1 receptor 32
SynonymsV1rc15
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8833 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location66552180-66560096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66553639 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 51 (M51T)
Ref Sequence ENSEMBL: ENSMUSP00000078536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079584] [ENSMUST00000227014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079584
AA Change: M51T

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078536
Gene: ENSMUSG00000062905
AA Change: M51T

DomainStartEndE-ValueType
Pfam:V1R 28 293 9.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227014
AA Change: M51T

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik C T 14: 49,773,861 V130I probably benign Het
Akr1c6 T A 13: 4,446,378 D132E possibly damaging Het
Atp10b A G 11: 43,222,159 E844G probably damaging Het
Bbx T A 16: 50,225,266 M311L probably benign Het
Bzw2 A T 12: 36,119,070 M153K probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
Cdh4 A G 2: 179,894,035 D793G possibly damaging Het
Ces4a A G 8: 105,131,982 I11V probably benign Het
Cpne9 T C 6: 113,304,512 L518P probably damaging Het
Dip2c T A 13: 9,575,483 probably null Het
Fam129a T A 1: 151,644,930 V125E probably damaging Het
Fam135b T C 15: 71,462,934 N804D probably benign Het
Frem3 G A 8: 80,612,772 D565N probably benign Het
Fscb T A 12: 64,473,223 T490S unknown Het
Fuca1 A G 4: 135,920,895 D31G probably damaging Het
Gbp8 G T 5: 105,018,802 N220K possibly damaging Het
Gfra2 T C 14: 70,925,897 F207L probably damaging Het
Gm9495 A T 8: 69,429,330 D331E probably benign Het
Grap2 A G 15: 80,638,483 N70S probably benign Het
Ifna13 C A 4: 88,643,920 E156* probably null Het
Jmjd1c G A 10: 67,218,383 R22H probably benign Het
Macf1 A G 4: 123,471,341 V3209A probably benign Het
Muc5b A G 7: 141,858,368 T1684A unknown Het
Naip5 T A 13: 100,222,934 E598V probably damaging Het
Notch1 G A 2: 26,481,603 T278I probably damaging Het
Olfr1426 A G 19: 12,088,279 V171A possibly damaging Het
Olfr177 A T 16: 58,872,596 Y185N probably damaging Het
Olfr618 T G 7: 103,598,237 F307C possibly damaging Het
Olfr729 A T 14: 50,148,366 C169* probably null Het
Orm1 A T 4: 63,344,701 E35V probably damaging Het
Pak1 T A 7: 97,854,632 I58N possibly damaging Het
Pard3b A G 1: 62,344,999 E841G probably benign Het
Pcdhb9 G T 18: 37,401,415 R154I probably benign Het
Pdpr G A 8: 111,125,680 V560I probably damaging Het
Pkdcc T C 17: 83,223,926 F455L probably damaging Het
Pus7l A T 15: 94,540,262 F234Y probably damaging Het
Rab3gap2 T A 1: 185,258,525 L632Q probably damaging Het
Rarb T A 14: 16,819,015 probably benign Het
Rom1 A T 19: 8,928,107 H236Q possibly damaging Het
Secisbp2 T C 13: 51,665,316 S311P probably benign Het
Slc26a1 T C 5: 108,672,316 D355G probably benign Het
Slc28a3 C T 13: 58,559,263 A574T probably damaging Het
Sox11 A G 12: 27,342,314 V32A possibly damaging Het
Spata17 T C 1: 187,183,239 Y107C probably damaging Het
Speer1 C A 5: 11,344,238 Y104* probably null Het
Stxbp5l T C 16: 37,204,452 T595A probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Tatdn2 T G 6: 113,707,387 I674S probably damaging Het
Tex14 T A 11: 87,493,052 S189R probably benign Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Tor3a T C 1: 156,655,803 T350A probably benign Het
Trove2 T A 1: 143,765,779 K315* probably null Het
Ttr T G 18: 20,666,493 V36G probably damaging Het
Vmn1r129 A T 7: 21,361,280 H4Q probably null Het
Zfp141 T C 7: 42,476,263 T262A possibly damaging Het
Zfp980 T A 4: 145,701,026 N108K probably benign Het
Other mutations in Vmn1r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Vmn1r32 APN 6 66552932 missense probably benign
IGL02399:Vmn1r32 APN 6 66552929 missense probably benign 0.18
IGL02964:Vmn1r32 APN 6 66552938 missense probably benign 0.37
IGL03161:Vmn1r32 APN 6 66553220 missense possibly damaging 0.65
IGL03244:Vmn1r32 APN 6 66553505 missense probably damaging 1.00
IGL03248:Vmn1r32 APN 6 66552913 missense possibly damaging 0.82
R0668:Vmn1r32 UTSW 6 66553660 missense possibly damaging 0.90
R0732:Vmn1r32 UTSW 6 66553706 missense probably benign 0.01
R1205:Vmn1r32 UTSW 6 66553555 missense probably benign 0.01
R1638:Vmn1r32 UTSW 6 66552955 missense possibly damaging 0.53
R1732:Vmn1r32 UTSW 6 66553301 missense probably benign 0.19
R2049:Vmn1r32 UTSW 6 66553561 missense probably damaging 1.00
R2127:Vmn1r32 UTSW 6 66553549 missense probably benign 0.09
R3773:Vmn1r32 UTSW 6 66553367 missense probably benign 0.01
R3834:Vmn1r32 UTSW 6 66553663 missense probably benign 0.02
R3980:Vmn1r32 UTSW 6 66553714 missense probably damaging 0.98
R4737:Vmn1r32 UTSW 6 66553645 missense probably damaging 1.00
R5569:Vmn1r32 UTSW 6 66553172 missense probably damaging 0.98
R6382:Vmn1r32 UTSW 6 66553361 missense probably benign 0.07
R6894:Vmn1r32 UTSW 6 66553361 missense possibly damaging 0.94
R7394:Vmn1r32 UTSW 6 66553189 missense probably benign 0.06
R7980:Vmn1r32 UTSW 6 66553321 nonsense probably null
R8867:Vmn1r32 UTSW 6 66553667 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACAAAGAGGTATTGGGACTGATTGTC -3'
(R):5'- GACAGGGTAATCCAGAATAATTAGC -3'

Sequencing Primer
(F):5'- TGATTGTCACAGCCTGGAAC -3'
(R):5'- GTAAGAATTATGCTTCCTCTGTGTTC -3'
Posted On2021-07-15